Description :
From Genome Similarity Track
Location :
contig_55:65000- 66808
Transcript NameFunction/comments
g9267.t1pre-mRNA splicing factor ATP-dependent RNA helicase prp16

Sequence
1808 bases(100 bases per row)
AATCAGATTGTGGTGATTGTTGGAGAAACTGGGTCGGGTAAAACCACGCAGTTGACACAGTACCTACACGAGGAAGGATACTCTAAGTTTGGCACCATTG
GATGCACGCAACCGCGTCGTGTTGCAGCAATGTCGGTGGCCCAGCGTGTCAGTGAGGAAATGGATGTGACTTTGGGTGACGAAGTGGGTTACGCTATTCG
ATTCGAGGACCTTACGTCGGACAAAACTATTATCAAGTACATGACGGAAGGTGTGCTGTTGCGTGAATCGCTGCGTGAGTCAGACTTGGATTCCTACTCG
TGCGTGATCATGGACGAGGCCCACGAGCGAGCTCTCAACACGGATGTGCTTTCGGTATCTTACGCAAGGTAGTCCAACGTCGCAGCGACTTCAAACTTGT
TGTGACGTCGGCTACGTTAGATGCTGACAAGTTTGCCGATTTCTTCGGTGGTGTGCCCATGTTTACCATTCCTGGCCGAACGTTCCACGTAGATACGCGG
TATGCCAAGTCACCCAACGACGATTACGTGGACGCTGCAGTGAAGCAAGTAATGCAAATTCATTTGTCGCACCCGCCGGGTGATGTCCTGGTGTTTATGA
CAGGTCAAGAGGACATTGAAGCTACCTGTTACGTGCTAGCGGATCGAATGGGCAAGCTAGACGGTGCACCCCCACTCATGGTTCTTCCCATGTACTCTCA
GCTGCCCGCAGACTTGCAGGCAAAGATTTTCGACGCCTCCGACGTGAGGAAATGTATTGTCTCAACGAATATTGCCGAGACATCACTTACTGTGGATGGT
ATCAAGTACGTTATCGATGCAGGATTTTGCAAGGTGAAGGTGTACAACCCTAAGATTGGAATGGACGCGTTGCAGGTTAGTCCCATCAGTCAGCAAAACG
CCAATCAACGTGCTGGTCGTGCTGGTCGTACAGGCCCCGGAGTGGCCTACCGTTTGTACACGCAGCGACAGTTCGTCAACGAACTACTTGAAGCGCAGAT
TCCTGAGATTCAGCGAACGAATTTGGGTTATGTGGTGTTGTTGCTCAAGTCGCTGGGAGTCTCCAACCTGCTGGAGTTCGATTTCATGGATCCACCGCCG
CAGGATAACATCATCAACTCCATGTACCAGCTTTGGGTCTTAGGAGCTCTGGACAATACTGGCGAGCTTACAGAAATTGGCAAAAAGATGGTGGTATTCC
CGCTGGACCCACCTTTAGCCAAGATGTTGCTATTCAGCGAACAGCTTGGCTGCTCTGCCGAGGTGCTTGTAGTCGTTAGCATGCTGTCAGTTCCAAGTGT
GTTCTTCCGCCCGAAGGATCGCGAAGAAGAGAGCGATGCTGCCCGCGAGAAGTTCTTCGTGCCTGAAAGCGATCACCTTACACTGTTGAATGTGTATCAG
CAATGGGAAGCCAACCGCCACTCAGCCCAATGGTGCTCCGATCACTTCATTCACGCGAAGGGCTTACGTAAGGCTCGTGAGGTGCGCGAGCAGCTTGTAG
ACATTATGAAGCAGCAGCATGTGCGCCTTCGATCATGTGGTGGGCGCTGGGATGTTATTCGTAAGGCAATTTGCTCTGCGTACTTCTACAACTCGGCGCA
AATTAAAGGCATTGGAGAGTACGTAAACATGTTGACGGGCATGCCGTGCAACTTGCACCCCAGTGCTGCATTGTTTGGGCTTGGTTACACCCCGGATTTC
GTTGTGTACCACGAACTCATCTACACAAGCAAAGAGTATATGCAGTGCGCTACGGCTGTGGAAGGTGAGTGGCTTGCAGAGCTGGGTCCCATGTTTTTCA
GCGTGAAA