Description :
From Genome Similarity Track
Location :
Scaffold_425:6500- 9811
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_425-snap-gene-0.13Ubiquitin carboxyl-terminal hydrolase
Pytir_DAOMBR486maker-pir_contig_425-fgenesh-gene-0.0Conserved gene of unknown function

Sequence
3311 bases(100 bases per row)
CCACTTACGCTTGGCTCTCGAGCACTTGAGCCTCCGTCGCGGACGTGACCTTGATGTCGTCAAAGAGAAACCACTGAAGCTGTGGACTCCAATCATCCTC
ACCACCGTCTTCACTCAGCTCACCTCCAGGGCTCTGGATGAACGCCGTGTAGTGCCCTCCTTGGACTGAGTCGCCGTGATGGTTGACCATCGCTGCGAGG
TCGTACAGACTCGCATCGGGGTCCTCGTGGTCGTCACCGGGGTAGCCAACATTATCGACCCCTCTAGGTGTCACTGGTTCGCTGTTTGGTGCTGCTGTAT
CAGATGATCTGTCTGCTCGGAATTCCTCCAAATCCAGCTGCTTGAGTGGGAACTGCACAAAGCCCGAGAGTTTCCGCTGCTTGTGGAAGTCCAGGCGCTT
GATGTGCACCACGAGCACGTTCGGGAGTCTGTGGATGCGCAGGCGCTTGCTCATATTGGTGTACGCGTTGCAGCGCCGGCAGTAGACGCGGTTGATGCCG
CGCAAGTGCTCCTCAGCTGTGAACTTGTGTAGCAGCGTGTCTAGAGACAGTGGCGGTGATGGTGATGACGACGACGACTGGGTATCTTTGGTATCATTGC
CATTAGCATCACTCCCAAGTACGTCCAGCGAGAGCGAGAGGTCCAGGAACGGGTCAAAGGTGCTCGACACCTGGTCGCACACCGCACACTCGACCTGCGA
TACGAGCACGCCCGAGAAGTGCTGGTGCGCGACGCAATCGCAGAGAGACTTGCCCTTGGGCGTGAAGCGCGGTGACATGGCCCCAGGCACAAACACGCGC
TGGTGCGTGTGTGTGTGGAGCACATTGAGGAACGCGAGGAAGAACTCGTGCGCGTCATGCTGCTGTGAACCGATGAACGACGGCGCAAAGTTCCAAAATG
CCTCCATGATCTTGTGAGGAACAAATGGCGAGGCTGGTGCGCTTAAAGCCGCGGCGGGGGACAAGGTCGCCATGAACTCGCTCAGGTCGCAACCCAGACA
GATTCGAGTCGACGGTGGCGAAGGTGATGGTGATGATGATGCCAACGACGTGGGAGACGATGACGAAGTCTGTTTGGCCGCTGCCGCAGCTACCGCCTGC
TGGTGCTGGAGCTTGCGCGTCTGCTTGCAGATCGTCGTGCCGTGTCCCTTTGCAACCAGAAAGTAGTGCTGCAACAGCGCATTGTGCGCAAACGCCTGTA
GCACGACGTTCATGTAGCATGTGTTGCCCATGTTCACGAGTCCTCGACGGGACGGTCTTCTTGGAGTGGTGGGAGGGAAGCTGCTGCTGCTATTGGTTAT
ATCAGTGCGCCAAACTTTGCTATGCAGGCGACGCACGTTGATCGAGAGCCCCCCGTGAGCTCCTCCGCCTTTTGCCTCAAGCAAAGCCTCAGGGTAGATG
AAATCCCGACAGCACGCGCAGTAGAGCTGCTGCTTGCGAACCAAGAATCCTATATCAGACGAGTGAATCCCCCATACAAGAAGCATAGTAAGCACATGTG
CCGCCCTAACAAGGTCTCCCCCAGGCAAGTTCCTAGCACGAATAGTACATACCAAGAGGATGGTCGTTAAGGATCGCGTGCGCCATGAAGCTGTCGTCGC
TGTCCTCACTGCCCGAGGCTATCGATCCGCTCAGGTACTCGCGGACGCCTGTAAACGAGCACGAAAGGCATTCGTACACGTCCTCCCGTACGCTGCCATC
TTGCTGCTTTTGGTCCTATAATGAGCCACAGATACACACAGTTAGGATCCGACCAGATAGTAGCCACACGGACGCACACACTACCTCCTTTGTATCGTTA
ATGGTGCACTGAAAACCTTACCTGTTGCCCTGCCCTGCAATAGCGCTCCAGTCGCTCCACGTCGTGAACAGCGCTCTTGCTCTTGCTCGTGCTCTTGCTG
CTGTCGCCATTGGCCGCTCTCTCGCGCAGCTGCTGTGCGAACGTGGCTACGGCTCGCGTGTAGTGCACGCAGCCGTCCACACTGCGGTTGGTGCGAGTAG
TGGTGTCGGTGCGTCTCCTGCGCTTGGGCGGCGGCGCCGCGTGTGTCGAGGCCGAGGGCATGGCTGCTGAGTGAGCTGGCGCTGCTTTCTTGTAAGTTGG
TGCTTTTTGATGTCGTCTTTCCCCCCTTTCTTCTCATTATTCTTGAAAACCATTTCACTCTTTTTTTTAGCGAATTGTATACATCCAAACCGTCATTTTA
TCCAATAATAAATGTTTATTCGACTCGTAATATTAGTCGGGATTATATAAAGAATAGATGCCCCCTTCCCCCGCTGCGAATATACTAGTAACGTTAGTAT
ATAACATGCTGGTAAATATAGGCGAGTGACCTGTTCCATGCAGCTAGCTGTTCGGAGGGGTTTGCTTTGCTTTTCTTAGCGTCACTCCATTTCTCGATTT
ATCATTACTGACTTTGCCCCCAACCGATCGATAGCTATAGCTGCTCTGTGTGTGAGGGGTCATAGGGTCGCGTGAGTCTTCTTCCTTCAGTCTGACGCCT
GAGAGGCTGGCTGATCGTGAATATTGCTCACACGACAAGGTCCAAGGCGAGCTGGACTGACACCAGAGCAAGTGCTGGAGACATCTACGTCTTCCCTACC
GAGCTGTGAGCTGTGCGGTTACCCCGACTTGAGTAGTCCTGATTACATCCGTACTTTGATCGAGAATGGCGATGAGTGAGCGTGTGGCGGCGTTCCTGTC
GCATCCCAGTATTGTCGACGCTATGAGTACCGAGGACGATGTCGTGGAAGTGCTGAGCGAAGTTGCGTCGCTCTCGGAGCAATACATCCCAACGCTGACG
TTTCTTATGCGTCCAGACAACCGTAAGTACCCCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGATGGATGCTTCTTACCATGT
TTTGCTGCCTGTGCTCTTCACACTTGGATAGTCACAGCACTGGTCAAGTGCATCTTGCATGAACCTGGTTCCACTGAAGGGGCTCAACCAACACCTTTAG
ACTGCGAGCGACACGCGCCTGGAGATGGCGAGTTCCCGTCCTACGACCAGTACGCGCTCGTGTTTAAAGCCCACTGGGTGCTCTGCGCTTCGGGTTTCTC
GTCCCAACTCATCGCAGCGCTCGTAGGGCTCCAGCCAGAGCCGCGGAGTGCCATCTGCGCTGAGATCATCAACTGCAACTCGCGCGACACGATGAACCTT
GAGGCGCTCGCGCGGTTCCTCAATGTGTTCATGGACCAGTACTCGCCCGAGACACTACTGAGTTTCTTTGGCAGCGGAGGTGGAGGAGAGGACGAACAAG
AGAACCAAAGA