Description :
From Genome Similarity Track
Location :
Scaffold_562:650- 8883
Sequence
8233 bases(100 bases per row)
CGAGTCGTCCGCGCTGATGGAGGCCACGAAGGCGGCCGAGGAGGTGGTGCGCTCTCGTAGCAGCACGCCGGAGAGTGGCCGTCAGGCCGGGGCTCGGAGC
AAGTCTCCTGACGCCGCGCAAGGCAAGGAGGAGAGTCCTCGGGGCCATAAAAGCCCGGCTCGCGACTGGGAAGCCGCCGTCTTTGACTGCACGATGGTCC
AGTACTCCGGTGAGAGTTCACCCGACGACGAGAACGTCTCGGAGGGCAGCACGCACGCTGCCGAAGGCACGGAGCTGGCGGCAGGCGACATGACCAACGC
CTCGGCCGACGCAAAGGCCTCGTCAGGGAAGGAGGCGGAGGACGCCGGCGACAGCAAGCAGTCGCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTG
GCCGAGAAGTCGCCGAGCGACGCGGGCTCCAAGCCCAAGGAGGTGCTGGCATCCAAGCATCTGACGCTGGCACAAGGTCGTGAGCGTGCCCAAGCGTCGA
AAGCGGCTGCCGCTGCGAAGGCCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTTTCAGGTCGCCTCGCGGCTCCAGCTCCAAGCTGTTCATCGACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCGACTCAGGTAACCCCTCCACTTCACGAGCAGCTGGCGCTTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTGGATCT
GCCCATTACGATCAAGGAGGGCCGGCGGTGGCCTCGCACGGCCATGGCTACGAGCCTGAGGCGACGCAGCCGTATACTGGGGCCCCGAGTCAGGTGGTGG
CCCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGCCGCTCGTGCTGG
TAAGCCTGGTGCCGTGGAGCGGCTCCGTGTGGATGTTGCCTCGCTCTATCAAGAACCTCGCAGTCTCCATGGCCATGTGGATCGTCGAGCCGACCTGTCG
TCTTACGACTCGCTGCGAAACCAGCTCGCTGGCCTTCGGGCCGAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCAGCCCCACTCGTATCAGGCCC
CGTTTGGCCAGGGCTCGTACGGGGCCCCTGCGTATGCTGCTCCGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCCTTACCGTGACTC
GACGCCGCGCTACGAGGAGCTGCGCTCTTCTCCACCGGGCCACCCACCGCTTCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGGTACCTCTTAAGCCGAC
CCACGTAAAACGTCGGGTGAGTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGGCATGCCGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGGG
CTTCAGCTTGTTGCTCTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAAACACGTTCATGTTTCCT
CTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCGCCATGGTGTCTCGCACCCTGCTGATTATGTTTAGCCTGTCTTCGGCAAACGAGG
ACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGCC
TCGTAATGTGAGCGACACCTGAGGGTGGCGCAACCCGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGTGGTCCGCCGTCGACATCGACATTCGTGTGCTGAGAAGGCGAAACAGCGTCTAC
CAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCAGAAGACACAGTCCATGAACAGGCGAGCGACCTCGT
CGCCAGTGACGGTGTCACGAACTGGAGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCAGCCGGAAG
TCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTTTGCAATGGTGCTGAGGCGTGACCGGCAGGCTTCACGCGCTGG
CACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGAT
GGCCACCGGATGGAGCGTCGTGCGCCTCCATCAGGATGTCGTACTTGATATTCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGACCCT
ATAGTGGAGCAAGCCATCAGCCCACTCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAAC
CGTACAAGAGGTTCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTCGG
GTCGGCGCGACAGCGCGTCGGCAAGCACGTTCAACTTGCCCAGCTTGTACTCGACACGGAAGTTGTATTCCGCGAAGAATGACAGGCAACGCGCCATCCG
CTGTGAGAGATGCGGCGTGTTGACGGCAGTCCGCAAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCACGAGGTGCACTCGGAACTTGACA
AGAGCGTACTTCATGGCAAGTAGCTCCTTGTCGTGGACTGGATAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGATGGCCCGTTCGCGGC
CTTCATCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTAAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGG
CGCGCGCTGTAAGCTCGCTTTGATGTCGTTAAAAGCATCTTGATGGATGGCGACGCTCCCAGCGCCAGTCGACATCGTTCTTCAGGAGATCCGACAAGGG
CCGTGCCAGCTCGGCGTAGCCTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGTGACCGAGGTGGCGGCCAAGCC
GCGATGGTTTTCACCTTCTCCGGGTCCGCCCAGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACACACTTGTCGA
TGTTGGCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACATCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTG
GACGAAGATGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCC
TGAGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAATGGGATGTCCCTCTCGCGCATCAGGATCTGGTAGTATTCGTCCA
CCAGGTCCAGCGCGCTATACAGCGTATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTGTTATAA
GCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCGGGGACTTCGACTCCCGCACCATGCCTGCTTTCGCCTTGG
CGGCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCAGCACGAGATCGATCTCGTGCCT
GATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCAAACGCCTTCACCAAGGGGTACACCGGGTCCCGGGGGTTCTTAAGA
ATCTCAGAGCCCATGCGCGACGCGCGCTGTCTCTGGAACTCCTCCAGGACTGCCTGGTCCATGACCGAGGACGAGTTCAACTCGGCCGACGTGGACTCCG
GTCGGAGGAGAACCAACTCTGCGATCTCCCCGGCCTTTAGCTCGGCCAAGAAGTCCTCCATAGCGAGCTCCTCAAGGTTCAGCAACTCTGAAACCTCGGG
CAGAGCTGTAAGCTCGACAGCTCCTGTCTTGACCCGACTACCGGTCACGCCGTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCGACGGACCCCAAGAAATCATTAGACGCTGCTGCGCCCTGGCGGCCCTCGCGGGCGCCCCAGCTGCTGCCAGAGGTGGGAACATG
ACTCACCAAAGCTCTGTCAGAGCGTGGGGGACGGCTGGCCCCGATGGTCTTGCCGCGCCAGTCGATCCAAGGCTCGTGTTTCTCCAGCCACGGCATGCCA
AGGATCAAGTCGTACTTGTCCATGTCTAGGACCAAGAACGGCTCCGTGCTGTCGAAGTCCTCGAACTTGACAGTGAGGTCCATGTGGACCCGAGGTACTT
CTACCACCGTACCGACGGCCAGTCTTACCGAGACCAGCCCGTTGCCTTTGCTGCTTCGTAGCGCATCGGCGTACTTGTCGCGATTGCGTGCGACAGTCTG
GCGGCGCGCAAAGTTCTTGGACGCCCCAGAGTCGATCAAGATTCTCAAGGGATGATCGTATCCCGGTACACTCGCGTGCACCACAAGCAGCCCACCGCTG
CCCTTCTCCGCTTCGAGAGTACAGAGACTCTCAGGGGCTAAGTCCCCATGGCGTGCGCCACCCGCACGCCCCTCATGAAGACTTAGTGTTTCCCCAGTAG
GGCGCCCCGCCCCTACAGGTGCCCGGCGTTCCCCTGGTTCCTGGGGCGCGGCTTCTGCCAGCGACCCCTAGAGCCAAAGGGCTTCGAAGAGAACTTCTTC
TTCAGTCCTCCCGCGGGACAAGCACGTTTCATGTGCCCAAGCTTGCCACAGCCGTAGCAGCGAATGTCGCTCTGCTCGGCCATGCCCAGATCCATGGGAA
CCGGCCCGTTGATCGCTCCATTGCCGGACTTACCATTAGGCGCACCGCCAGAGGCAGGGTTGCTCTGCCATACTGTGGCGGGGGTACGAGCCTGCTTGTG
GTTGTACTCCTCCTGGAGGGCGATCTGAATCGCCTCCTCCATAGTGTTTGCTTGCACACGGAACAGTTGCGCGCGGGCAGGACCGACACGCAGACCGTCC
ATGAACACGGTCACCTTGATGTGTTCAGGCAGGGGGTTCCCCACCAAAGAGGCAGTGAGCACTCGCATCTCCTGGATGTACTCATGCAGCTCGCGCCTTC
CTTGTTTGCAGGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGAAGAAACGCGGCCCGCAGCTGCTCGCACAGCTGGGACCATGATGCGAA
GCATCCAGGCGTCGTCGCTTCGCGCGTATACGCCCAACTCTAGCGCGACCACTAAGGTTGGAGAGCGCAAAGGCGACACGGAGTCGCTCGTCCGAGACGA
GAGCCGCGTCCATCGCGAGCTCAATCTCTCGAACCCAGAAGTGAAGGTTTTCTCCTTCCTTCCCTTCGAAGGGGTGAACCTTCAGCCGCAGGGGCTTCGG
TTGCACCGGCTTCGGCGCGGCCGCAGTGGCCTGCAGCCCTTGAACGTGGGCGATGAGCCCTCGCTCGTAGGTGTCGAATGCGTTGATACGCTCAACCTGC
TCAGCCGGCGTCGCCGCCGCTAAGCTACGCAGGGCATCTGTCCCAAAGATGCCTGCCATCTTACGAACGGACTCGTACTGCGAGTCGTTCAGATGGGGAA
ACTCCGTTCGATCCATCTTGGCTCACTCGATGAGACCACAGAGGATTCAGGTAGTCCAATCTACCCGCGTAGGCGTAGGATTGACTACAAGTGCTACCAA
GTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAGGAGTATACAAACTCCAAGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGACGACTT
GCCTTGAAAAGCGGTAGATATAAGACCGAATGTATTTATAGGTTGGTACAGATTTGGCCTGCATACAAATCCTAAGTTCCCTATAGTTTGTGTCATACAA
ATTGTATCTGTTGGCTCTGAGGCTACTTGGGTCACTATCCAGGGGAGTGACCGATGTAGCCATCCCAGAATAGTGACAGGGTCACTATTTCATGTAACCC
CGTTACAGTATACGACCCATTTGAGATTCTACCGATTGAAGGATCATTTCTACCAATCTTCTCTAGCCGACAAATTGTATCCACTCGACAAAGCAGGAGG
TATTATAATACTTTCAAAGCCTGGGACGGATGGCCGAGGCGGATTGCGACAATGGGAAAAAGAGGATGTAGAGGGTCTGAAGTACTCCAGCGTCTGGATA
AACCTCAGGCAGCTTGATAAGCGAACCATAGCCCGACCTCATGCAAAAATGCGTAGTATGCTGTTGTGCCAGACTCCACCAAAATCGGTGGTGTTCGTCA
CCTTGTTCTCCATTCGGTAAAGCTCGTCCCCCG