Description :
From Genome Similarity Track
Location :
Scaffold_1540:650- 3272
Sequence
2622 bases(100 bases per row)
GTACCTCTTGAGCCTTGACACATTGAATGTAGAATGGAGTCGCATTGCCTTGGTGATATCGAGCGTGTAGGCGTCGCCTCTCTTGAACGACACCGTGAAT
GGTCCAATATAGCGGGGCAGCAGTATGTCAGCCCCAAGATTCGTCACAGAACTGGGTGCGATGCCATCGCTCGAGAGCAGAACACGCTCGCCCACTTCGA
ATGTCGTAGTGTTTCCCCGGTTGTGTCGGTCTGCTTGTTTCTTCTGCTTGTCCACGGAGCGCGCGATCGCGTCCCTCACAAAGCGGATGATCGTCTGGCG
TCGCAACACAAAGTCAGTCGCCTTGTCGGAGCCGTGCGTCGGCTTCTCGTTGCGCGCGAAGTTCCCGACGGGCGAGTTGCGCGCGCCGTGAGCAGTATCC
TCGCGAGTATGACGGCGTCTCGGACTACCAAGAGATACGGGTGCGGCAGGTGGCTCTCGGATCAACTTACGAGCGGCCCATTGAGCAATTAACGACATCC
GCGTGATAGGTGCCGTCGTATTCGGTGCCCGAGAGTGCGCTTGAACTGGGGCGAACTCTTCTTCAGCCGGAGGCAGCGTCGCTGGTTCTGGGACGATGGT
GACAGCTGCAAGTGGTGCATCGGTGATAGCGCATCTATCTGGAGTCGCGATCAGCGAGTCCCCTCCCCCACCAAGAGTGGAGTGACCTGTTTCGCTCCCT
AATAGGGCCGGAACACAAGGATGTCGTGCCAACACGACGAAGAAGGGTGAAAGGCCGGTCGAGGAATGAACTGCATTGTTGATCGCGAACTCGGCCATCG
GAAGAAAGTCGCTCCAAGACGACGTCGACGTCCATACTGATGGATGACCACGTGTCAGGAGGAACCAGAAGTGGCTTCAATGGCGCTCGGAGTGCGGGTG
CCGACTTCACGCGTTGACATGTCTCGCAGGTGCGGACCCACTTCCGCACCCAACGGTACTGGTGAGGCCAATAGAAGTCACGTGATACCGCGAGGAAGGT
CTTCTCACGTCCCAAGTGACCGCCCACGGCGGCATCATGATACTCGTGGAGAATACGCGAACACAAGTCATCGTCATTGGGTACCACGGCGCGAGATGAA
TCATCTGGCGCCACATTATACGTCAGAATCCGGTCGCGTATGCCGTATCGGTGCCGTGCCGATTGCAAAGGCGTCGGCACCTTCTTCAAATTTGCCGGTG
TCGGGTCAAGGAGGTACCGCAAGAGCGGGCCGTACCAGGCGTCGCGCTCCAACGACACAGCAAGCGATTTCCACAAATCAGTCACGGCAGACACAGCAGT
GGCTGCAACGCTCTCGGTGATACACGCGGCACATGATTCATCTTCGTCTTCTTCGGGAGCGGGTGCGCCGCCCCTAGCGTCATACTCTGGACGTCGCGAC
AGCGCATCCGCCAAGACGTTCGACTTGTCGGGCTTGTAGTGAACCACGAAGTTGTAGTCAGGGAAGAATGACAACCAACGGGCCATCCGCTGCGAGAGGT
GCGGAGTCTTCATGGCCGTACGCAACGAAGCATGATCGGTGTGCACGGCGAAGCTGGTTTCACCAAGGAGGTAGACGCGGAATTTTATCAAGGCGTATCG
CATGGCGAGCAATTCCTTGTCGTGGACCGGGTAGTTCCGCTCCGCCTGCTTCAACTGACGCGACTAGTAACTGATGACACGCTCGCGTCCATTGTTGTCA
AACTGCATGAGTGCGCAGCCGATCGCAAAGTTGCTCGCGTCGCAGACGACATGGAATGGCTTATCCGTATCTGGGAGTGCCAATACTGGGGCTTCTGCAA
GACTTTTCTTCACGTTTTCAAACGCGGACTGGTGCTCAGGGAGCCAGTCCCATTCAGCGTCTTTCTTCAGGAGCTGCGTGAGAGGACGGACCAGCTCCGC
GTAGTTGCGCGTGTACTTGTGAAGATAGTTCGCGAGACCAAGCCACTGCCGGAGATCTTTTGGGTTCTTTGGAGTCGGTTACTGTCAAATCGACTCCACC
TTCTCCGGATCAGCGCGAACTCCGTCGCGACCCATGTAACAGCCGAGGACTTGGATCTCTGGAGCGCAGAAGACACACTTCTTGAGGTTCGCGTAGAGAC
TGTTGGCCCGAAGTGCCTGGAAGACCTGCCGAAGGTGCCCGAGATGGGCTTCCACTTCTNNNNNNNNNNCTTCCCATCCATCGACCGACTGTGAATGAAG
ACATCGTTGAAGTAGCTCGGGGCGAAATCACGAAGGGGTCGCAGCACGTGCGATACCATCCGATTGAGCGTCGCTGGAGCGTTCTTCAGGCCTTGAGGCA
TCACGAGCTATTCCCACAGCATCCCACTCGGCGTGCTGACAGCGGTGAGAGGCACATCGCTCTCTCTCATTAGGATCTGATAGAAGCCATCCTTCAGATC
CAAGCTGCTGAAGATGGTGCTCCGCGTCATGGAGTCGAGCACCATATCTTTACGAGGGATCGGCGTCTGTGCGGGCACGGTCGCGTCGTTCAGCTTGTTG
TAGGCGTGGACGATGCGCCACCCTCCGGTCGCCTTCTTCACGCAGAATGTCGGGCTGCAGTGTGGCGACGAGCTCTCGCGGACGTGGCCAGCTCGGCGGC
GTTTTTCGAAGAAGTCGTCAAT