Description :
From Genome Similarity Track
Location :
Scaffold_1750:650- 2719
Transcript NameFunction/comments
Phyta_totarag13603hypothetical protein

Sequence
2069 bases(100 bases per row)
GGACAATGGGCGGTGTTTGACACGGGCTATTCCGATGCAGAGTGAGTCAACCGAGACAAGTGGAGTCATGTCAGCAGCTTCTACTCCGGTTAGAATGCCT
CGTAAGATGATGACCACAGGCCCGGAGATACCTAAATTTcgcacaagctcaagcggaGAGAGCTGACCCGCCTCTTCTTGCATAGCAATACGTGAATACA
AGGCTTCGGAAGTAAAGCGCAAGGAGGTCTACCCAGTGACACGGAGTGGACGTGCGTCTCGATGGCTAGGTGATTTCATTCATCTGACATTCGTGGAGAT
AAACCCAGTGAACTCAACATCTGAGGAATGGGGAAGCAGCACggcaagagctgcagcatgccacgtgcgaaggagaaggcgctaGCTTGGTCGCAGGACT
ATTGCTGCCATGCTACTAGTATGATTATGGAACCTGACCCGCTAGAAGAGGCCAAGGAGAGTGACCATGCACAGCAGTGACAGAAAGCTGCTGATACTGA
GTACGATTCTCTGATGAAGAACGACGCATGGGAGTTAGTGCCAAGGACACATTGCATGAAAATGCTGCGGAATCGATGGATATTCCGCGTGAATTATCTA
GCAAACGGAGAGATCGAACGGTTTAAAGTCCATCCCGTGATCAAAGGTTTATGCAGATATACGGCATTGACTACCTGGAAGTGTACCCGCCGGTGGTACG
TCTTGAAACTCTGCGCGTCGTGTTGACGCTGACAGCAGTATGAGACTATGAAATGGAGCGCATGGATGTAACCACCGCGTTCCTTAATGGAGGTAGTGAT
ATTGAAGGGTTCATGAAGCAGCCTGAGGGGTATGTGATTTCAGGAAAGGAGGACTGGGTGGGCCCCTTATGCAAGCGTGTTTATGTATTCAAACAGGCCC
CAAGGGTCTGGTTTCGGCTCCGCAAGTCGTACCTGGAAGACCAAGCTACACACGGCTGACGTGGGAGTCATGCGTGGCGCTCAAGGTCGTTGATGTGAAG
CTGGTATTCATAACGATCTATGTTGATGATTTGATTTTGTTTGCGTCTACCAAAGCACTCACACGTCAGATGAAGCAATTGCCGATTGATCGATGTGCGA
TGAAGGACCTCAGTGAGCTGCACTATATCTTGGGTTGAGCGATTACACGGAACCGTCGTGAAAGGTCAGTTTTTATCAGCCAGCGTAAATATACGGCGAA
GGTGCTAGACCTAATCCGAATGAGTCAATGCAGTCGATGCAAGACTCCAAGTACCGCTGACTTGAAACTGGCCAAGACCATGTGTCCGACGGATGCTGAT
GAGAGAGCACACACGCCGAGCAGGCCGTATCGCGAAGTAATTGGAAGTTTGATGTATTTAATACTAGGAACACGTCCAGACTTAGCCTACCTAGTTCGCG
AATGCATTCAGTTCCTCGATAATCCGGGAGTGCTGCTTTGGCGTGCAGCCAAGCGTGGCCTGCGCTATCTACGAGATACATTGGACTGGGGCTTACGTCT
TGCAGGGCCATAAAGGgcagacaagaagctggatgGAGACCTGGATGCATACGTCGGTTTGGATTTCGCTAACCACACCGATGACCGCAAGTCCGTTGCG
GGTTATCTGACGAAGTTTTGTGGAAGTACTATTTCGTGGAGCAGccagaccaagaagacggtggcgTTGCACACGACGGAGGCAGATTACATGGCGCAta
gcctacatgtacaggaAGTGATTCACCTACGTCAAATGCTGAAAGAGCTACAAGGTAAGCAGCGTGTTCCCTCACAGACGTTTGTGGACAACCAGAGTGT
GAAGAAACTAGCGAAGAATCCGGAGTTTCACAAACAGGACCAAACACCTTGACGTGAGTCACCACTTCGTGCGAGCGCGCATAGTGCTGATGCAAATTGA
CGTACAGCTTGTACCTAGCATCGAAAATGTTGCCGATGCCTTCACGAAGGTGTTGTATGTGTAAAATTTGAGAAGCACAGTGCTGCAATGGGATTTATGT
CCACTAACAAGTTCGAGCAGTCATGAAAGCAGACCGACTACTAGTGTGTGGGACGGCTGCGATATACTG