Description :
From Genome Similarity Track
Location :
Scaffold_1335:650- 1673
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_18619pectate lyase

Sequence
1023 bases(100 bases per row)
TCGCACCGTGGTGAACGAAATCGCCGCAGTTGACAAGTGCGTCCGGGACGCAGTCGCGATCGAGCGCCGCCTTGCAGCTGCCCTTGTTGGCGTTCGTCGT
CGACATGATCCAGCCATTGGGCTCGGCGAGATTGGGCGACGTGGTCGCAGCGAAAAAGTTGCCTACCGAGAGCACGTACGCTTCGTCGACCTCGAACGAG
TGGCCCGAGTTGTCGTGCCCGTAGATGTTGGCGGTGTGGACTTGCACCAAGTACTTGCCGAGTTGATTTTGGGCGCGCGGCCGGAGGTTTTCTGAATGAC
GTTGTTGAGGTAGCTCACCTTGAGGTTGCTGATAAAGATGTTGGTTCAGTAGTGGCGGCCGTCGCACGTGGCCGACCACTCGGTCTCGCCGTCAAAGTCG
CAGTTGCTGACGGTGATACTGTTGGCGCCGTCCGTCGTGAGCATCAGCCGACCGACGTTGGAGATTTTAACGTGGTCGATCCAGATCTTTAGCTGAGCCA
TCGGGCTTGCCGTTGAGGTAGATGGCGTCGCCGCCCCAGACGGACTGCGGGTTGAGGTTCGTCACGTGGACATTCTGGAGAATGATGTTGTCGCCGCGGA
GCCAGAGGCCTTTGCCGACAATGACGCCTCTCTGGCCCTCTCCACGAATGGTCTTGGCGCCCATGACGGCGAGCGGGTTCTTGGTACCGGCCACGTCGTA
CAAGACTTGAACGGGCGTGCCGTTGGTGCAGCCGCCGCAAGGATCACGTCCTGGCTCTTGAAGGCTTTCTTCTTGGCGATGCACTCGCGCGTGTAGTCGG
GACGGCACTCCGTCTCGGACGTTGTTCCTTCGGTGCCGCGAAAGTCGAACGTCTTATTGAGGGCAATGACCCGGGGCACCGCTTCCTGGAGGTACGCCTT
GAGCTCGTTGGTGTTTTTGGGGTAGACGGGTGCTGCGTTGCCACCGCCCGTGACGCCGGCAGCGACACCAGGCGTGCTCGCACCCGAGACAGCGTCCAAG
GCAAAGGCGAGGAGGGCAAGTAC