Description :
From Genome Similarity Track
Location :
Scaffold_785:65- 5521
Transcript NameFunction/comments
Phyta_totarag10709hypothetical protein

Sequence
5456 bases(100 bases per row)
TAACTATGTTAGATAGGTAACCCGATACGTTTACACGGTAGGCGGCGTTGCCGCAGATAAGTGAATCCATATCAGTCTTGTTTAAGAAGGAAAGGTGTTC
CTTGAGCCTTTAGATCGTTATCTAAAAAGTGTAGAAGTTCTTGTACGAAGTTGCGTCTGAGACTCACAAGGCTCACCGagtctacgtcttcctctgacgT
GTGCTAAGCAGCCTCACTgcacctggtagcacttgtaGTTAATCCTACACCTGAGCCTTACGACTGACCGTCTGTGAGGATGGAGTATTTCCCCCACCTC
CCTCAGaaccagcaggacgagctTAAAAAGCTGATGTCCTTGCTTGGTCCGGAGGTCGTGACGCATCTTGTTTCGCAAGGCCCGGAGGTGATTAACGCGC
GCCTTGAGGCGGTCTCAAGTTACGAGAatgctctgctggagcacattCAGCAGAAGGTGGCTGCGACGGCGATGGCCACACCGGCGTCTACGACGTCAAG
AGAGACTCCCAAACCGAAACCGCTCATGGTGAACGTCCAGGTCTTCGAAGGGACGTACGGCGAAAATCTCCTATTATGGACCCGCGAGGTCGGAATGGCT
ATGAATTCAACCATGCTCCGAACTGATCAGCAGCGCGATAAGCTGGCAATATCTAAGCTCGGTGGAAGAGCCCGATAAGGGGACTCACATGCGAGGTGAC
TGTTGATACCACTTACCCAATCTGGGAAGGTCTGAAGCGTCAGCTGGCGAGAATGTTCTCTCAGCCTAATCCCGCATACCGCGTGCGCTATCGTTTCTTG
GCTTGCCGTCAAGGCAAAAAGGAGTTGGTGGACTATGTCCAAGTGCTACGCACGCTCATTGCTGGTATGTTTGCCGACCCCCTGTCTGAGGTAGTCACCG
TGACAGTGTTTATGGAAGGTCTCCGGACCGGGTTGATCGAGCGAAAGTATTTCGAGTTCACCCATCTTCGTTTGATGAGGCCGTCGCGGTGGCATTGAAT
GCTGagcacaacttcaagtcgGCCCGACTTAGTTGGAGGGCATCGCACCCAACCCCCTCGGGTGGTCCGTACCCCATGAACCCTAGCTACActgaagacg
aggaagctgAGCTTCtagctgctgagcagcgtAAGAACACCCGGGCGATGATTTACCTGTGGCAGTACTCGACCTTACGCATGGGATACCCCCTGCGCAA
ACAGCGCCAGGCTCAGCAGAGCCTTAGCTCCGCTCCCAAACAGGCCTCTGGTTCGTCGCAGGGAAACGGCGAGTCCCAGTAGGCGTGGGGCGGCCTACTG
GGAACGAATCGAGTTCTGTTGCACTTCGAGGATGTATAGGTCGACAGGACTCCGCTCCTGAAGAGTTCCGAACTCTCTAACACGGACCGTGTATGCCAAC
CAGGCTTGCTGGCCGTCCAGGCGACCGTGAAAGTCTTTGAGAAGCCGCGGGCAGCTTTTATTGACTCCAAGGCGTCGGGCAGTTACGCTCGACGCTCTAC
GATAAAGGGAAAACAACTGTATGTTGGAGCGCTGGCAGCGCACAGAAGTGACAGCGTCACCGTTCGCCTGGCGACTGCGACTAGTGTCACGGTGCCCAAG
GTCGCGGTGGACCTGGGCGTGAAGTTCCTGGACTTTGACAGTATGGAGCTCTGCCTGGTCCTAGACCTGGATTCGAGGTACGACCTTATCCTTGGCATGG
CATGGATCGACTGGAGGTCGAAAATATTAGGTGCTGCGCACGTCTCTGGTGGGGCCTTGGCGAGTCATGACCCACCTCTGCTAGGAAACAGAAGCGCTAT
TGGCGCGAACACTTGGTCGAGTCGgccatggtgctggacattGGTGTGTCCGAGTTGATGGACAACGCTGAGGTCGGGGATGTATAGCCCGAGCACGGCT
TGACGTGCTGACGTCGAGAGACCTGAGCACGCCTCGATGGACCGATGTGGAGCGGTACGTAATTCGCTGAGTGGTGGTCGATTGGTCGACACATCGCTGC
GTGCAAACGAGAGCACGGTCGGCTGCGAGTTGATGTATCAAGGGCTTTGCCCGGAGAATGCGCGTGGAGCGACACGTATTCCGCTGAGTGGGGCTGTCGG
TATGGCGCACCACTGAGTGCTCACGCGAGCGCTGTCGGCAGTGTGTCGAGGCAGCAAGGGCCTGGTCCTGGAGGTGCACGTGAGGTGGTTATAATTCCAC
CGTATCATGGACATTTATCGCCGAGCGTCCTTGAGGACACGGGTTCCACCGGGAACGGTAGTGCTTTCACACCGGTACGGGATGTCAGTGATGCTGCTCC
GTCGCCCTCTTCCACCTAGTCTCGGGCACGGATGAGGGTGATACGCAGAGCGTCGGTGACGTCGTCGGTGTCGGACGAGATGTCCAGCGTGTCAAGCAGC
AATGATCAATGCAACTGCAGCGAGCTGTTGTACACACTCGTGAATGCAGTGACGGGGGAAGGTGATGGCGACATCGGCCTTGAGTCTCTCCCCACTGTTG
AAGCTCTTCtagagctggacgagatgtcTGTCGCCAAGTTCGGTGAGGCCTTGAAGGTGGGCGATTTTGCCGAAGTGGTCATGATACGACCTAAAGAGGA
ATTAAACTCCTCATCCCTTGTGAATTAGGCTGTCCTTGAGACCACCTAGAAGGCGCTCAATGCGACAAGCGGATTCAAGATCCTTAAAGATCCCTCAGAT
CCGTTCTATCTGTTGCTGGTAGAGTATTGAGACGTCGTCTCGAAGTACCCACCTATGGGTCTGCCTCCGGATGGAGGACTTCGTCACAAGATTGACTTGG
TTCCGGGAACCAAATACTGCGTGACGAGGCAGTGGCCTCTGCCAAGAGAACAGTGCGGCATCACTGACGCGTTCCTCCCTGCAAGGCATGAGGCTAGTCT
GGTGGGTGAGAGTAAGTATCTACACTCTACACCGACATTCTGTGTCAGAAAGCCAAACGCCAAGTGGCGCATGGTTCATGccttcaacaagctgaatGCA
ACCACCATTCCGGCGCAGACTCCAAATCCTCGGAAGGACGTTTTCCAGAACAATATGGCCGGCTGTACGCTGTACAGTGTCTCGACTTGGTTAATGGTTA
CTACCTGTTGCTCATGAGAGCGACTTATATCCCGCTAACAGCCGTCAGTACTCCGAGCGGCATGCTCTGGGAGTGGCTGGTGATCCCCAAGGGCTGTTGA
ACGCTCCGGAGACGTTCAATCGTCTGGTGACGCAGTTGTTCCGGCCCCATCGGGCGAACGCACAAACGTACTTTAATGACTTATTTGTCCACAGTCGTGC
AGACCACGGGAAGTCAAATGTGGAGAACCACATAGACCATCTGcgagcagtgctcgagtacatgtGCACCAGCGACTTATACGCCAACTTGGACAAATGC
GTCTTCGGCGCGGAAGATATCCCGTTCCTCAGGTACTTCATTGCGAAGCGAGGCCTCGAGCGGATCCTGCCAAGGTTAAAACCATCGTAGTGGGCCAGTT
CCAAAGAACGAAGAGGACTCACGCAAGTGGTTGGGCCTCGTCAATTACTTGCACAAGTTCAGCGAGGATTACGCCGAAATGACAAGGCCATTGATGAATC
TCCTTAAGAAAGATGCTGAGTGGTGTTGGGACACCAAGCAAGGAGCCTTTGAGGTGATTAAGGAGAACCTCCTCCAGGCGCCGATCCTGGCGCTCCCGGA
CCCGGACTGTTCGTTCAGTGTCGTGTGTGACGCATCCGACTTCGCTATCGGATGCGCTTTGCTTCAAGCGGACGCCAAATGGCGCGAACGCGTAATCGCG
TTGAGTCTCGGCAGAtcaaggctgctgagaagaACTGCCCAGTTTATGATAAAGAGCTACTCGCAATGAAGTACGCGCTCGTCAAGTTTCGGATCCACCT
GCTCGGCTCCAAGCCTTCGTGGGTTACACGGACCATGCGTCATTACGCACTGCGACTCAGTCGCCTCACCTCTCTCAGAGAATAGCCCGATGGCTCTCCT
GCTTTGCGGATAATAACTTCGAGGAAAAGTTCAAGTCGGGCAAACATAATGTTTTGGCTGATGCGTTATCACGCAGACGGGATTATAAGCTTGCTCATGT
CACGACCGTGACGTTGTCCATGACGGAGCTGATTCGGGCGGCTTACGCAAGCGACGACACTTGTGTAGCTCCGCTACTTGCTCTAGGGAGtgaggagttg
ctggaatCGTACATGAAAATGTCGGTGCGCTCTCGCGCGAGGCTACATCGATATACGCTCGATAATGGCATGCTGTATTACAGCACAGGTACGGACGACA
CGCCTCCCGTGGCGGTCCCTCAGGAGGAGGACTTGAAGTATCCCATCCTCTATGAGGCCCATGACACACCACTTGGTGGACACCTTGGTCGTGAGAAGAT
CTATTGCGCCGTCAGCGCAATGTACTGGTGGCCGAAGTTGTTCAAATGGCCCAGCACATGATGCGCACGTATGAGTCGTGTCAACGGGTGAAACCCTAGC
CGCATTCGGGCGCGCCATTGGTGAGTTTGCCTGTCCCCACGGGGTGTTTGCAGTCCATGAGTATGGACTTTGTGTTTGACCTGCCGAAGGACTCGGCGGG
CAACAGTCTTTGTGGACCGACTGAGCAAAAGGGCTCACTTGGCGGCTGTGCAGGACTCCGTGGACGGAACGGGTACAGCTACGCTGTTTATTGACCTTGT
CTTTCGACAACATGGCCCCCCAGAGACGATTTGCTCGGATCAAGACCTCCGCTTCGCGGGGAAGTCCGTCTTCGATATGCTGGGCACTCGCTTGGACTTG
TCCACGGCGGGTCATCCGTAGACCGACGGCCAGACCAAGCGCGTTAATCACGTAGTGAAATACGTCATCCACAGCGTGTGCGCTCACACGCAGATGCGTT
GGAACGTCATGACCCCTCTCGTCGAGTTCGCATTGAACAATACGGTGCACGCCTAGACAAGCTTCACCCCGTTCTACTTCAACGGCTTGGCACACCCTCG
TGTTCCGCTAACACCGCCACGCACAGGCCTTGGGCTTGGTGGGGAGAAGTCGCCGACTGGATAGCAGATATCAGCCCTTCTCCTGTGCGTAAGCATGTTG
ATGACTTCTTGTCAACGCGTCTCAATGTCTTGCGACATGTGCTTGACACAATGGCTGAAAGTCAAGATGTTGAGAAAGAACAGGCTGATACAAGAGATCG
AGGCAATGTTGAGAACTTTGAGGTCGGGGACCTGGTTTTATTAAATGCCAAGAACCTTTCTATGAATGCAGTTTCGGTGGtcttcaagacgaagctgcgc
cCCCGCTTCGCCGGACCGTTCAAGGTCGAGGCCAAGATGGGCCTAGAGTATATGCTCAACCttccgaagaagatgcgtACACACACCCAGTATTTTACAT
GGACTTGCTCAAGCCGTATCCGGACCCGTCCCTGGTGAATGCGGAGGCGATGGCGC