Description :
From Genome Similarity Track
Location :
Scaffold_241:65- 4823
Transcript NameFunction/comments
Physo_144677pol protein

Sequence
4758 bases(100 bases per row)
CGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGTTTCATCTGTGGTGACACCCGTCACCTTCGTGCTGGGTGTCCGCTGCGC
CATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGATCGAGCCAGGGCTCTGGTTTGTCTCGGGGAAACGAGAAGTCCCAGTAGGCGCGGGGCGGCCTAC
TGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCCGTACTCTCTAACACGGAACGTGTATGCAAG
TCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACCAAGCCATGGATGATTTTGATCGATTCGGGAGCGTCGGGTAACTACGCCCGGCGTTCTA
TGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGACATCGTCACTATTCGTCTCGCGACGGGCACTCGTGTCACGGTGCCTAA
GGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGACATGATCTCATCCTTGGTATG
GCGTGGCTAGAACGCCATGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCTTGGCGGAGCATTGGCGAGTCATGAACCCA
CCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACTGGGCCGAGTCGGTCGATGTGCTGGACATCGGAGTTTCCGAGTTGGTGGACACTGAGTGTGT
CGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAAGTGGAGCGGCACGAATTCCGCTGAGCGGGTGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCC
AGCGACGGCGCGGTCGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGTGGAGTGGCACGTAATCCACTGAGTGGAGGCTGCGGATCGT
ACAGCTCTTCGCTGAGTGTCGGTAAAGACACTGGAGCTCCCTCGGAGCTGAACGAGGTGGTGACACCTGGCGTCAAGACGCACGCGAAATCACGGAGCTC
TACAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACGCAAGGCGTCTGCAATCTCACAAGTCGAGAAGGGCGTGTCG
AGCGGCGAGGCTCCACGCGAGAGCGAGCAACTCTACACACTCGTGAATGGAGTGACGGGCGACGTCGACGGAGGTATCAACCTCGACGACTTGCCCTCAC
TGTCTGCTCTCCTGTAGCTGAGCGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCCGAGGTAGTGCTCATACGACCCGAAGA
AGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCCGTCG
GATCCCATGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGCTCGAGGTGTTCGACACGAAATCGATC
TCGTTCCGGGGACGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGCGGG
CATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTGAAT
GCCGCTACCATTCCGGCACAGACGCCGTTTCCTCGGAAGGATGGTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATG
GGTATTACCAATTGCTCATGAGGACGAGCGACATCCCTCTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGATTGTTTGGTGATGCCCCAAGGGCT
TTCGAACGCGCCAGCGACGTTTAATCGTCTGGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGCACTTCGATGACATCTTTGTCCACAGT
CGTGCGGAGCACGGAAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAAAACAAGTTGTACACCAACATCTTCG
GAGCGGAAGAGATCCCCTTCTTAGGGTGTTTCATCGGGAAGCGTGGCCTGAGGGCCGACCGGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAA
GAACCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTGTCCAATCTCCTG
AAGAAGGATGCGAAGTGGTGTTGGGGCACCGAGCATCAAGATGCGTTTGTGGCAATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTCTGCCAGACC
CCGCTCGTTCGTTTAGTGTCGTCTGTGACGCCTCGGACTTTCCCATCGGCTGTGCCCTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGCGTGGTGGCGTT
CGAATCTCGCCAGCTGAAGGCTGCTGAGAAGAACTATCCTGTCCACGACAAGGAGCTACTTGCAACGAAGTATGCGCTCGTCAAGTTCAGGGATCACCTG
TTGGGCTCTCAGTCGTTCGTGATTTACACGGATCATGCGTCGTTACGCACTGCGACTCAGTCGCCTCATCTCTCGCAAAGGATGGTCCGATGGCTGTCCT
TCTTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTCCGGATTATGAGCTGGCTCATGTAACGACCGTG
ACTTCGTCATTACCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACTTGTGTCGCGTTGCTGAAGGCTCTGGGGAGCAAGGTGTTTCAAGACTCGG
ACATGGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGTTATTCCCTCGATGGAGGCCTGTTGCTCTACAACACCGACCCCGAGGATACGCCCCGCGT
GGTCATCCCTCATGATGAGGATCTGAAGTATCGCATCCTCTATGAGGCACACGACACGCCGCTGGCAGGCCATCTTGGCCGTGAGAAGACCTACCGTTCG
GTGAGCACCCACTACTGGTGGCCGAAGCTGTACAAGTGGACGAGCACTTATGTGTGCACGTGCGAGACGTGTCAGCGAGTGAAGTCGTCTCCTCATGCTG
CAGCGCCGTTGGCGAGTTTGCCTGTCCCTTCGGGCTGCTGGCAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGAAGCGGCAGGTAACACTGG
AGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGAGACCATCGATGGTAAAGGTACAGCAACGCTGTTCTTGGACCGA
GTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCCGCTTCACATGTAACTTCTGGAGCGCGGTCTTTGCGGTGCTTATCACCA
ATCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACCGAGCGCGTAAATCGCGCCGTCGAGGACGTGCTCCGCAGCATTTGCGCCGAGAC
GCCGAAGCGCTGGAGCGCCATGCTTCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGCTTG
TCTCATTGTCCGCGTCCCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGGAGAAGCTGATTTAGCTGATCGGCTAGCTGATGTCAGCCCGGT
TACTGTTCGTAAACAGGTTGAAGCTTTCTTGTCGACGCGTCTGAGTGTCTTACAACATGTGCGTGACGCAATGGCTGAGAGCCAAGACAAGCACAAGGAA
CATGCAGATGCCAGGGGCAGAGGCAATGTTGAAAGTTATGAGGTCAGGGACCTGGTGCTGCTTAATGCTAAGGACCTATCTACACATGCAGTGTCTGCCG
TCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGAGGAC
GCACCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAGGACCTGATGCAGGTGCAGATGGAGGCGCCAAGGGTGACGAGGTCACAGGCGCGGAGGTCGA
GCTGACCCTGAAGCACAGCCTGCTGACGCTGTAGCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGCACCCAGTCCTCCAGGGC
CCCAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCAAGTTCGGTGGCAGTCCGATCCAGACGCGCATCAACG
TCATGGATATGATCCCGAAGGCGACCCGCCTGCTGTCGCACCTCCAAGAGCTCACTTTGAGTCGCAAAGGGCCCCACAGCGGCCTCCACCGGCCCTGCTC
GATGAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCAGAGTCAAAACCAGTATCTGGTGAAATGGCGAGGGTACCTTC
ACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCACCAAGACTGCCCAGACGTCGT