Description :
From Genome Similarity Track
Location :
scaffold_464:65- 3703
Transcript NameFunction/comments
g8581.t1hypothetical protein

Sequence
3638 bases(100 bases per row)
GAGTCCGGATCTCGGCGATGTCGGATCTAAAGGAGTTCAACGGCAAGGATCTCGACGAAGATCGCGCCCGAGCCTGGATCAGCAAGGTCAAGTCCGCGTT
CCAGCGAGATCAAGCCACCGAGGAGGAGAAATGCCTCACCTTCGCGGATCTCATGATCGGTCCGGCGAAGAACTGGTATCGACAACTAAGTCGAACGGCC
AAGACCAAGTGGGCAGATCTACTTGACAGTTTCCAGACCCAATACTGTGGTCTAGGGATGTCAGTGGCATGGCAATACTACCATGCACGCAAGCGATCTG
AAGAAACCCCGCTCGATTATCTCTATCGTCTGAATGTGGCGGCTCTGCGAGCCAAACTCAAGATCAAGGACGGAAATCCCAAGGCCCGCCGGGAACACGA
AGATCACTTCATCGAGACTTTGGGTGATCCCGAGCTGGCCGATCGCCTGACCTTGCTTCGACTGACTGACGTCGACGATCGGGAGGAAATTCTCCGCGCT
CGAGAACGAGCGAAGAGCCGACAGCGACGATCTGCGTTCGGATCGAAGTATCGACAGAAGACTTCATCGAGAACGCCCACGGCACCCGCCAGGGCCGTAG
TGCGCGCGATCCAGGCCCAAGACCCGAGTTCAGAGTCAGAAGGGGTGTCCGGATCAGATGGGTCCGACTCTGAAGGAGATCTACGAAGGATCTACCTGGC
TGCGGCTGAAGATCAGTCGATCGGCGCTGGGGGCGGGTCCCACCCGCCAGATCAGGCACGATGTCGCCCCAACACGCAAGATCGAGGCCAGATCTCCGAT
CACCGGACCCGCTCCGACCGTGATCACCAAGATCGAGGTCGATGCTCGCATTGTGGATCCAGGAAACACGCGGATCTCGATTGTTGGAAGCGATTGACCT
GCGAGAAGTGCGGGAAGAGGGGTCACCCGACGGATCGCTGCCTATATGTGTGCCGTGGGTGTGGAAAGGTCCACGAAGCCGGAGAATGCATCATGGAAGA
GTTCTACAACCAGATCCGCAAGTGGTATGATCCGACTCGACACGCAGGAATGCTTCCCAAGAAGGTGGAGAAGATGTTAAACTAGGACGCTCGCCGGGTT
GGAATCCGGTACGAGCCGAGCGTTCTAAGTACTGCATCTACGCATACGTGAACAAGAAGTGGGCAGATCGAGGTAGGGAGGACTCAGATCTACGCGGTAA
TACATGTGACTTGCATACATACACCGCCAAGATCGCGAGTCTACCTAAGATCGATGAGTTCCGCCGATCTGGTGCGGAAGTAGCCCTGGATCTCAAGGAT
GGAGAATCCCGAGGTTACTGGGAATATCATGCACCAGGGAAGTGGTTCCGACAAGCCAAGATCACAGGCAAGATCAATCATGAGAAGGCGATCTTGCTCC
TGGACACCGGTGCCGAGGTATCTATTTTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCACTTTGACACTAGTCAGAGGCAGGAATGTGTGGGAATTGG
CGATAACGTGTACACCACAGAAGGGAGAACAAGGATCAAGATCACGCTGGCAGGATATCTGGTGTACTTTTTCGACATATGGATTGGTGATCTCTCAGGC
CAAGATGCGATCCTGGGTATGGATTTCATGATTCCGGCCGGAGTCCGGATGGATCTCGCCAAAGGGTCGATGTGTCTACCCGACGAAGTCGGGATCCCGC
TTAACGGTCGCAAGAGACTGTACGGTGACAAGGTGCGATCGATCGCCCTCGAGGAAGATCTGCAGATGCCGGTCGGGGAATCGGAGGAGGCAGCATCACG
AGTGAAGTTGGGTGCTACGGAGAAGCTATGGGTGATCATAAGGGAACAGTGGGTACCTACGGTTGTGGATGGTCCAGGTCGAACCCGATATCTGGTGATC
TCGAATCTTGGAGAGAAGATCTTGAGGCTAGATCATCGTCTCAATGTCGGAATGGTACTGGACCAAGAGAAGGTACCTAGATCTCCAGGTTTCGTGTCAG
TGGGATCTCGCCGCTACATGGAGTGGCAGAATCTGGCACTGGAAGCCACTGTAGAGGCTTGATCAGAACCCCCAGAGATCCCAGAAGGGCCCGTGGAGCC
GCTTGTGGAACGCCCAACGTACGCTACACCGAGATCGATACTCCGCCGGGGCGGAACAGCCGAGATTGACCACGAATCCGCCTCGATATTGAGTCTGGAG
GCTCGATCACAGGTGCGATCGGCCGGCACAGGCAAGATCCGAGTTGCGTTCCTCAAGTCAGACGGAGGCGATACATCTGAGAAGCAATCTGGATTTGATC
CATGTGGGACCCTCAGTGACGATGCTGGGGGCGGAGGAATATGTGAGAGCATGTCAGATCAGGCCCCAGAACGAACTCACGAAGAGAAAATAGAGATAAA
AACGAGTGATCCAGGATTTCAAAACGGAATCACGCCCGAATCTGGTGCTAGTGGGAGGACCGGAATCGACTCCCCCACGGGAGATCGAGAACGGCAATCA
AGTCCATTATCACGAGAGTGGTGATCTTTCAGTCGAAGATCTCGCAGACAACCTCGCCATTGTCCCGGAAATCTCGATCTCGACTACGGAAGAGGTCAAG
ATCGAAGATCTACAGGTAGGCGACCGAGGATTGGCCACCTCACAGGAGATCGAAAAACTCCGGCAGATCATCTGGAAGAAGCGACATCTCCTGATCGGCA
AAGGAAATGCACTGCCACCGGCCGCCAGAGGAGTTGTATGCGATATCGATGTTGGGAATGCGAAGCCGATCGCGCAGCGAGTACGTAAAGTAGCGCCACA
GTTCCGCGAGAAAGTGTCAGATCTGATCAAGGGACTCTTAGCAGCCAAGATCATCCGACCTTCAACATCGCCTTGGGCGTCCCCGATCGTGGTGATCATC
AAGAAGAACGGTGTGGATATCAGGTTGTTCATCGATGACAGGCTGATGAACGGCCTTACGAGGCTGATGATCTACCCGATGCCCCTGATCAACGATCTAC
TGGAAGATCTCGACAAGGTTCTATGGTATTGCTCACTGGATATGGCAAGTGGATTCTGGGTTGTGTCGATGACCGATCGAGCTCGCGCGATCTCGGCGTT
CATCACTCCATTCGGTCTGTTCGAGTGGAACCGTATGCCTTTCGGCTTGAAAAACGCCGCCCAGATCTATCAACGTCTCGTGGATAACGCCCTATACGGA
TTCCTGAAGATCTCGCGATCTAGTGATTCAGAAGGCTTAGTTGATGTGTTCGAGTCGGGGGTCCCGGAAGATCCGGGTCAACCATCGGTGCTGGAACGTA
GTTCATATATCGATGACATCATGATCACCGCCGGGTCATGGGATCAGATGTGCCAAAAGGGTGGAAGATCTGCTGGGAGCCTGCGGTAAGTGGAACTTGT
CGATCAGTGTGGCGAAGAGCTTCTGGGTTATAAATAAAGTGGAGTATCTCGGACATAGAGTGTCGATCGAAGGCCTGGAAGCGAATCCAAAAGATCTGAA
GTCTTTGACGGATCTACCATTCCCCGGATCACTTCGATCCATGCAGTCATTTTTGGGGAGCTTGAATTACTACAGTCGATTCATCGAAGATTACGCGGTG
TACGCCTCGGTTCTGTATGAGCTACGTGAAGTGGAGTT