Description :
From Genome Similarity Track
Location :
Scaffold_1924:65- 3475
Sequence
3410 bases(100 bases per row)
GGGGATCAGAAAATCGTCGAATGTAAGAATATTACGTCCTTAACCCAGACGGGGTCCCCAGGGATCCCCCTGGTGTTCCCGGCTCGGAATGGATTCCACT
TTTGCAGTCACCTCCCCCGAATACACCCGTTTCAGGCTCCGGTATTCGGAGAAACCCATAGAGGGCGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCG
TTCTTCAGTCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGA
AACCACTGGCCATGTCTAGAGAACAGTACCAGAGTGCTTTATCCAAATCTTCCAACAGCTCATTGATCAGAGGCATTGGATACACCATCAATCGAGTCAG
GCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGCGACGCCCACGGGGACGTTGAGAAGCTG
ATGATCCTGGCTTGCAGCAGGCCCTTAATAAGATCTGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGC
CGACATCGATGTCACATTTGACTCCGTGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGCAGACG
ATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCGGTGGTTAGTGGTACCTCCGGGATTACCGCCATACCT
TCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTGATCCACCCTTGGATCCAGGCACCGCGACT
CTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTATCCTGTCGGATCCAGCCGGTCCTCTAACGAGTCTAAACC
CGACGGTTCAGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAAGCTTGGATCCACTTGTGGATCGGCGGGATCCGGC
TGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCTCCCGTCGTGGATCCAACCTCCATTG
CTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCAC
CTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTCTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGG
ATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTG
GTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTCTTTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCC
GGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCCGGGAAA
CACAGTGTTCCATCTGCCAGATCCAAGCTTACTCCGGCTGATACCATGAAATCCATCCCGAGGATGGCGTCTTGACCCGCGAGATCTCCAACCCAAATAT
CAAGCCAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTCGGATCCG
ACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATTTAGGAGTAGGGTTGCTTTTTCATTGTTG
ATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAACAT
CCTCAGATCCATAGGATCCAGTGACCAGACATACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTC
CCAATAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTTGGATCTGGAAAACTCGTCCACTTGGCGCAAACTAGAGACCTTGGCAACT
GACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAG
AACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAAAC
CATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATATCCGGGAT
GACCCTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATGCAGTGTGTTTCCGGGATCCGCACTGCAAACACCTGACTTGTGCTGTCCC
GTCATGAGATCTCGGGATCTGTACATCCCACGGTTCCCGGGTACGGTATTTCCCGATCGAGAGTTGTCTCCGGTCTTCGCCGCACGATCATTGGATGCAG
TGAGACAGACTCGGCGGTAATCCTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACGCGTCGAGC
GGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCC
TCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTA
CCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCCAGCGGGGATTCATCCGATCTGCGGCGAGC
GTGGTAGTATTGTCGTGCCACCGACACTCTCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGC
TGTCGATACCAGTTTCTGGCTGGCCCCGCTAGCAGATCCCCAAAGGTCAGACACTTTTCAGCATCCGACGCTTGATCTCTCATGAGGGCTGACGTGACTT
TGCTGATCCA