Description :
From Genome Similarity Track
Location :
Scaffold_256:65- 2479
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015074Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
2414 bases(100 bases per row)
GAAAGTTGCTGGTGCGTTCTTCAGACCTTGTGGCATCACCATCCACTCCCACAGCATACCACTAGGGGTGCTTACTGCTGTAAATGGTACATCACTCTCA
CGCATACGAATCTGATAGAATCCATCTTTCAGATCGATCGCGCTAAAGACAGTGCTGCCAACCATTCCATCAAGGATCATATCCTTTCGTGGAACTGGAG
TCTGAGCAGGTATGGTCGCATCATTCAATTTGTGGAATGCATGAACAATGCGCCAACCGCCTGTGGCCTTTTTAACACAAAAGGTGGGACTACAGTGCGG
AGACTTGCTCTCGCGCACATGGCCAGCCTTCTGTCGCTGCGCGAAGAACTCATCGATCGCATCGACTTGTTCCTTCGGTAGCGGCCATTGCCTTGTGATA
CAGTACTTTGTTCCCGGAAGTACATCTATCTCGTGACGAATGCCTCTATCCTGCGGCAATTCGTCCGGCACTTTGTCTGGAAATATGTCAGCATATTCCT
TGACAAGCCCATACACGGGGTTTATCTTTAGAGCGTCCCACGACTGCTTATTAAACCTTTCCTTCCGTGTCCTTTCATCTAACACTTCCGCAGTGTTGAT
AGCATCGCCGGCAACTTCATCGACGATCACACAAATTTGCGAAATTTCGCCTTTCACCAGGCTACGCTTAAGCGTCTTCTTGCTCATCAACGGCAAGGAA
ATCAATTCTTGAGCCAGACTTGGAGGATTTTCCACTTGCACATGACGCGCTATCTGGCAGTCGCCTTCTTCATTGTAGACTACGACGTTCACGTATTCAC
TTGAAGTGGCTTGTTCCTGCCTCTTCACTTCATCTTCTGCCTTCCTTGTGTCTTGATCAGGGACGCTTGCAGATCTTCGTTCTTCTTCATCGGTCTTCTT
ATCTTCTTTAATCCTGTCAGAGCAGACTCTTTATCGCTCTTGGCCACAGGAGTAGTCTTTTCTGGCGCCTGACTACTCCACCTCCAGTGGTCTTCACGGG
CTTGTCATTTGAGTGTGAGGGCCATCGCACGCCTGACTCTCATTAGACACATCTTCAACAGATGTATATGCCCAAATCACCTCTCTTGCTGTCAAGCAGC
CGAGGTCTTCGTCGACTTGCTTGTCGACGCTGATCTTCTTCTTCTTCCAGTCAATGCTCGGTTGGTACCTTCTCAACCAGGGCATCCCAGAATCAGATCA
AACTTGTCATCGAGTCGAGTGCTATAAACTCGTCTTCACCTCGAAAATCATCACATTCGATGCCATACGCAACACGCGCTTAGGCATCGTCACTTTCGAC
CCATCGCCAAGCGAACGATCATTTCTTGTTCGAGATAGGCAGGTCCAAACCTTGCCTTCTCACCACTTGTGTGCGGACAAAATTGTTCGACGCACCAGTG
TCTACAAGAGCCCGTAGAGGTTCTGAGTAACCATCTACCTTAACCTTGTGGACTATCAAGGTTGGCTCTTGCTCGACACGCTCACATCTGTTCGCGGAAA
CTTCATGTGCGTTACACACACCGGGGCAAGAGTTCTGCGCTTCCACGACATTCACAGAACTCTTAGTTTGCCCAGTAGGGAGCCCCGCTCCTACTGGTCG
TTCCCGTTTTTTGGCTGTTGGGAACGCTCAAATTGTCGGCCTCTGCCTGGTCGATTCGATCGCGGACCGTGCGTCGCTTGCTGGCTTGGCAAGGACACCT
TGCAATTTCTCGCGATGTGGCCGGGCTTGCCGCAACGGAAACACTTCCCGTCATTGCGTGGCTGTCGACTTGCAGTCACATTGGCATACGAGATGTCCAT
TGGCTCTGGGCCATCATGAACAACGTTTGGTTGCCTTGGTGGTCTTGCCGGAAAACCTTGGAATTTGGCTTGCTTGATGCTGAATTCTTCTTGCATCGCA
CGGCTGATGGCTCCTTCCAGGGTCTTCGGGTACTCACGGAACAGCTGGTTCCGAATCGGACCATCGTTCAGACCTGTCATGAACGTCACGACTTGCGTTG
GGATGTCAATCGGCTCGTCCACGATGCTCGATACCAAGTAGCGAGCTCGTTGTGCGTACGAGTGTAGGTCGTATTTACCCTGACGAAGCTTTAAAAACTC
TGCGCGAGCCCGAAATTCGCTCTGCGGAGGTTCAAAAGCCTTCTTCAGCTCTCGCTTGAAGTCGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGC
TTCCCATACGCCCAACTTTTCGCTCGACCCGCAAGTTTTGACATTGCAAACAACACTTGCTGTATTGGGTCCCGTAGTTGTCTTGCAGTGATCGCTGCAT
CCAACTCAACGAACCATCTCGCTAGAGGCTCGTTCTCTCCGCCACGGTACGGAGATACATTCGAGCTTCAGAGGTGCTACCTCTCATCGTCGTAGAGGAG
TTGCAGACTGTCGA