Description :
From Genome Similarity Track
Location :
Scaffold_3513:65- 2067
Sequence
2002 bases(100 bases per row)
CTCAGTACTAGCATTCTGGTTGTGGCCAGCAGTATCGCGACGGCGAGCGGCAGCAGCACCATTTTGGCGTTGACTAACGGCATCTCGACAGCGACCAGCT
CCAGGAGCAATGCGGGTGTCGTTAGCGGCATCGCATCGGTTTAACGCAAATTCAGCACTAGCATTCGGGTCGTGGCTAGCGGTATCGCGGCGGCGAACGA
AGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCCTTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACAACAT
CCGAGGCACTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCAC
TGTGTTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACTCACACAGGAAGCGAATCCG
ACGTCTTCCTCTTCAGTTATGGTCTGGGCGACCGTGAGTGGAGCTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCT
GCGGAACTAAGCTACCCGCCTGTGGACCTATGTTACTCACCTGGCCGGCGCCTCTTCTGGGCGCGGCCACCATGAAAACATACTCGGAGTCGTCATATAC
GTCGACGACTCCCAAGCATCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCT
CTGTCGGACTGCGCAGGGCGGCTGGCGCCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGGCCAGGATCATATCAT
ATGGATCCCATATCGAGAACAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCC
CCGTCGGCCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCG
AAATTCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGATGATCGTATCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCG
ATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCACAGTAGGGCGCCCCGC
CCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCG
CGGGACAGTCGCGCTTAAAGTGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGG
GCTTGTTCGACCGGGAGCCGACAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGTCTGTACCCTTCCTGAAGAGCCACTTGAATT
GTCTCTTTAAGGGTGTTTGGCTGCACCCGGAACAGCTGAGTGGCGGGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTG
GGTTTCCCACTAGGGACGCCGTGAGATCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCG
GTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGAGAGATGTTGCTTCCCGAGTGTACAC
CCAACTCTTAGCACGACCGCTAAGGTTAGAGAGTGCAAAAGCAACACGCAGCTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGG
AC