Description :
From Genome Similarity Track
Location :
Scaffold_3891:65- 1144
Transcript NameFunction/comments
Phyta_totarag15532reverse transcriptase

Sequence
1079 bases(100 bases per row)
TGTAACAGGGCACGGCCTATGGCAAAGTCCGACGCGGCGCACACGACGCTACAAGGACGGTCATCGTCTGGCAAAGCCAATACAGGCGCACTTTGCAGGC
TACGTTTGATGTCCTTAAAGGATTGCCGAGTCTTGTTGTTCCACGGCCATGGTGCATTTTTCTGAGGAGGTTCGTAAGTGGCCGGGCCATCTCTGCGTAG
TTGGCGCTGTACTTGTGCATGTATTTGGCCAGGCCAAGCCACTTGTGCAAGTCCTTCTGGGATGTTGGCACTGGTCATTGTGCGATCGCGCACACCTTCT
CCGAGTCAGCGCGAACACCATCCTTGCCAAGGAAGCAGCCCAAAAACGGGATCTCTTCAGCACCGAAGATGCACTTGTTGATGTTCGCATACAAGCGATT
CTTTCGCATGCCCATCCAAACCTCCCGGAGGTGCTCAATGTGCATCTCGATGGccgtcttgccgtcctcgGCGCGACTGAGcacgaagatgtcgtcgaag
tacATCTGTACATACTGCCGCATCGGCTGAGAGAGCTGAGTCACCAACCTATTGAACGTTGCTGGTGCGTTCGACAGCCCTTGGGGCATAGCTAGCAACT
CCCACAGCATCCTACTGGGAGTGCTCACCGCTGTGAGAGGGATATCCGACTCGCGCATCAACAACTGGTAATAGCTGTCGGCCATGTCGAGTGCGCTGAA
GAAGGTACAACCCACCATGTTGTTTGGCAACACGTCCTTCCGCAGGAttggcgtcgacgtcggGATTGTAGCtgcgttcagcttgttgaaAGCATGCACC
ATGCGCCACTTCCCGTTGGGCTTTCGCACACAGATCGTCGGCGACGAGTGTGACGACTTTGATTCGCGCACCATGCCCGCGGCATATttggcggcgaaga
aggtgtCGATCACATGGGCTTGCTACTTCGGTAACAGCCATTGGCGTGTGGTGCAGTACTTGGTACCGGGTGCCAGATCGATCTCGTGTCGGACGCCCCG
ATCCGGGTGGTAACACCGACGGTGGGTTATCATAAACTACGTCAGGGAATTCCTTCAAAAGGGAATGATACGGATCCGA