Description :
From Genome Similarity Track
Location :
Scaffold_303:6499- 8572
Transcript NameFunction/comments
Physo_125608reverse transcriptase

Sequence
2073 bases(100 bases per row)
AGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCA
AGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGGC
ACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCAC
CTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAG
TGCGTCACGCACCTGTTGAAGGTTGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCAAGA
GAGGGATATCGCTCTCACGCATTAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATAACATC
TTTTCGAGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAAC
GTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTTCGAAGAAGTCGTCGATCGCTTTGACCTGCTCTCGCGGCAGAG
ACCCCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTACGTTACCTTGGCTCT
TATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGTTGAGGCGTGTGACTCGTCTGCGTCATCCGTGCCCCTTGAGGTCGGAGACTC
TTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGATGCCGACGCTTGCTGCTCTTGCGCGCGT
GCTCGCGCGCGCCCAGGGCGGTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAGCAGGGC
GATGAAAAAAGTTTACAAGAAACAGGTATTGTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTCTCCCAATCGATGACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGAAGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTA
CCATACGCTTCTCGGTCTTTACGATGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTACCTTTAAATCCTCGAAGTTAAGCCTTGATAGACT
TCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGTTGCTCTCATCGAGTTCACGTTCAGGATGACAAGGTCAGGCTTGTCATCTT
GGTTCTTGCAGTGAGAATGAACCTCACTGGGGACTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGC
GCCTACTGGCGTCCAGCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCAAGGGGCCGTGCACTCCCGAGCAAA
GTGACCGATTCTACCGCATCGGTAGCATCGCACATTGTTTCCTTGCGACTGTTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCT
CCCGTCCTCACTACTGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTACATTGCAAGAGTAATTGCAG
CTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGT