Description :
From Genome Similarity Track
Location :
contig_30:649887- 652630
Transcript NameFunction/comments
g5402.t1hypothetical protein

Sequence
2743 bases(100 bases per row)
TTGTCTATCTTTTGGTGAATGCTGGGGTTCGCTGCTCCTCGCGAAGATTGAATATGTAGACACACGTGGAATGTTAATGGTTGGTGGTAATTACTTGTGG
CTGGTCCAGAGATTTAAGCCACCGGACCCGACAGCCCAACCCGGAGGTTGAGTTCAAGCACAAGTGACTTTGTGCCTTACCCAGCAAGGGCCGGGATCCG
TACCCCTCATTACACTATGGTTTTTTTTCGGCAGTGGGGTCTCGTTGCGGTAAACGACCGACCTATGGGCCGGCTACTCGTCCACTTAGTTGCCTATCTC
CGGCCTCCGTAGATCGACCGCACTCGGCGGGTATTGATCCCGGTACCTCCCGGTCTCAGCGTCAGGGTATTACCACTGGCCCACTGAGGTCGGTTTGTGG
CTGGTCCAGAGCAAACGCAAGATAACCTTATTCAAGTCACACGTGAAACTGAATAAAACTAAATTGAACAATGAGTGCATCTAATTGTATACTGTATTTA
TAAGGTTGAACTGACGCTACTCAAAGCCGTCGAGCTCCATCGCATGCGTAACAACCATTATTTAGCATGGCGTACATGAGCCCATGTACGTCCAACGAGA
TTGAATGTCGACCCGATAGTGCCACAGCATGCTCTCCACGTCCTCAACCGTCGCGTACATAGTGACCGTGAACTAGATCAGCACTCGTGGGGTCAACATG
GTTTGCTCACGGCGACCACTGCTGCAATGGGGTTCTTGTACAACTTGTCCGTAAACAGCTCCAGCGCAGGTGGGCCCAACACTTACATGGGGTCGGCATC
GCGGTTGGCGTGGTGTAGCTGGTTAAGCGCTTGAAAGTAAATTGCGAAGTGATATTGGAGTTAGAGTGCCTTGCCGGCATGTTTCCTAAAGCTGCTACCC
TTGGCTGCTCCCTATGATCCTCTTACTCCTCCTTCAGATCGGTCTTCGTGCTCCTTACCATCTGAAGCCTCTTGCTTTCCCGTCGATCGCTTCACCGCTG
TGAATCCTCCTCTCAGCAGTCTCCACGTCTCCACATCATGCCTGCACTGCCATCGTGCAGGTGTCATCGAAGCTCACACCAATAGCCAAACACCACGTCG
ATGCCTGCTGCCTTGGCAGCACATCGTCCCAGCGCTCGCCATGATCTCAGCCACTAACCGGCCGCCACGGTCGACATTGTCACGCTCTCTACGAGAGCTG
CCTTCCCAATGATGGCTCCGAGCACTACACTACAGCTTGCGTAGAGTCTAGTGGAGCATAGGTTCCAACTCCGTGTGTCCGCCATCAGCAATGTATCGCT
GAACAATGGTCGGGACATCCGAGTAGACGGAGTCAAATGGTTCCCACGAGTTTTCATTGTCCTCCAAGCCACGCCACGCGACGAAAAGCTGCCATTCTTT
TGCTTCATCGTTGTACCGGTGCTCTGTAATTGCGCGCACGCCAAGCACAATGCCTTGGTTGGCAACGTTTCGCGGAGTCCCTCCGTTACATCCAAATCGG
CATCGCAGTAGTGCTTTAGGCGAGAGCCGTGGACCTCATAGACGTCCTTGGTCAACAAATGTTCCACCATGAACGAATTGGCGAGGGCTTCGGTAACTCG
GAACGGCCCCACCCAACGAACGAGCAGTTTGCTGCTCTGCAGTCGTTTATCCACGCGTAACCACAACACGTAGTCGCCTGGCTCGAAGTTGCGCGTGCTA
CCCTTTGACCTGGCCATGTTGGTCAAACGCTTGCGTTCCTTGCGTTCCACGACTTCACTATGCATTTCGCGGAAATGAGCATGCAGGTTGTCAAGCTGCT
CACTCAGACGCTCTAAATCCAACGACAGCACTCGGGGTGTCCGTCCATCGGGCACCACCACACAGTCGAGTGGCGACGCAGCTGGGAGTCCAGCAAACAA
CTCAACGGGGGCGTGTCTTCCCAGTGATTCCACGGCGGCATGGTTTAAATTTGCCTGGATAATAGGCAACAAGTACAGCCAGTTGCCTGTGTCGAGTTGA
AGTTCCAGCAGCATGACCCGAAGCACTTGCAATATGTCCCGGTTTACTCGCTCCACAGTCCCATTGATCCAGGGCGTGTGCACTGGGACGAACTTCTGCG
TTGCATGCAGACGTCCTGCCAGTTCCTTCATCACCTGTGCCTTAAAATGCGAGCCGTTGTCGGAAACCCACTCTTCTGGCAGCCCGAATCGCTTGAACCA
ATCGTGCACAGCCTCCGTAGCAACGCTGCTGGTCGGTGCATCCGAAGCGGACAACTCGCAGTAGTGTGTTAGCTCATCCTTGAGCACTAGGACGTAAGCC
GAGTCACCGTAACTCTCACCAAGAGACAGGTAGTCGATGTGTAGACACTGGTTCCGTCGGGTTGCCGTTGCGGTTGGACACCATGCCCTTTGAATCAGCC
GGCCACCTTTGACATGTTTGCACAGCAGACATTTCCGAGCAAAACGACTGACTACTTCCCGCAGCCGAGCGATACTGAATCGCTGCTGTACACTTGACAG
CATAACGTCGGCACCACGATGTCCTTGTTGTCCACAGTGCGCAACTATCAGGATGCGCTGCAGTAATTCCTTAGCATCACCAGGTATCCAAATCTTCCCA
TCATGACGAAACACACCATCGTCATCTGCTGCAACAGGGGCTGCATTACGATAGCGTTGTTGCTTCTGCCGAACAGCATCCAGAGATGGCCACTGAAACG
CCGCATCTTGTAGTGGACGTAATGATGACAGTGGCTGCACACT