Description :
From Genome Similarity Track
Location :
Scaffold_60:64965- 67696
Transcript NameFunction/comments
Phyci_105335conserved hypothetical protein
Phyci_93907Hypothetical protein

Sequence
2731 bases(100 bases per row)
CCTCTGCGTCTTACCGCTTGCTCAGGTTGACGAGCGCCGACAAGAACTTGGCCTGGTCGGCCGTACGATGCACGTACACGATCTTGTCTCCGCTGAAGGA
AAAGTTGCTGACTCCCTCAATCGTCACGCGGCGACCCTTCACGCTCTCGATGAGCTCCAGGAATTCCTTGTTCATGCTGACGCCGGCGCTCTTGATCGTG
CCAGACAGCGCCCAGTGCACGCGGAAGTGCTGGCTGCGTGGGCCGCCGCAGTCCACCTTGGCGTGGTGCAGCCGCACGTCACCGAACAGGTAGGTCGTGC
AGAGGTAGTCGAGCACGAGGGCGTCCTTGCCGCGCAGGTGCACGGACGAATTCTGCGGGCCGCTGACGATCGAGTCGTCGCGGAAGAACTTGACGGTGGA
CAGGATGTCGCCCGAGTTGTAGGCCTCCTCCACGTGCTTAATGATCTGCAGACGCTTGTTCTGCAGCTGCTGGTACTCCTTGTCCGTGATGGTAAGCACC
ACATTGGAGGCCACGCCCGAGTCCTTCTTCTCCAGACTGCGGATCTCCTGCACCAGCATGTCGCGGTGCTGCTCGAGGCGCATCTTCTCGTCCTCGAGGT
TCGAGATGCGGTCCAGCTTGCGCTGGCGACTCTTGCGCGCGGCGATGCGGTTGCGCTCCCGGCGCAGGTTGGTCTCGTCCACGGAGCCGTCCGACTCGGA
GCGGTTCGAGCCGTTGGTGCTGGCCGAGGCCTGCGCCGCCACGTACGGGTCGTTCTCGTAGGCGGACATGCCCGTGTTCTTGGAGTACTGCATCTGGTTG
ACCATCTCGTTCAGGCTCTCGCGCGTCAGGCCGCCGCTGGAGGCGGAGTTGTCCATTACGTAGCGGTTCACGGGTTCGGCGGGCGACGACTTGTGCTTCT
TGGTAGCGGGCGCGCCGCGCGGCTGCATGGCGGCGTGGGCGCTGGCACGGTAGTAGCGGTCGTCGGCCATGGCGTCGTCCATGCCGCCCGAGGCCGGCGG
CATGCCGCGCGAGCCCATGACGCGGCTGTCCATGACGGCGCCTTGGCCGCCGCCGCTCACGCGGCCGTTGCGTGACAGGTGCATGGAGCACACGCCCTCG
GCCACGGCTTGGTTCGAGCACAGTGCGATGGCGCAGCGGTGCAGCGAGTTGGACAGGCGAGGGTTGGCGGCGCCACTGCCGCTGCTGGGTCGTCCACGCA
TGCTCATGGTTGAGAGGAGGTCGGGGGGTGAGGCTGGGGCGCTTCCTGTTTCTGCTGGGCGGTTTACGAGTGTGGTGAAGACAGCGAACGCTCGCTCGCG
GAAAAACAACCGCGAAAAACCTCGGGAATTTGTGCAAACGTATTGTTGACTTGCTTCTAGTATGTAGGACCTTCCAGATAAATAAACCTCGGCTGAAATT
GATTCGTCCGTACCGTTAAGAAAAAAAAAGAGCCAGTGGAGCGAGAGGGGCGCAGCTTACTTGGGATTTGTATGAGTTGCCACGGGGATCTGTTGCCGAG
ACTAATTTTTGGTCCGCGTGTTTTGGTCCCGAGGTCGAATACATACGACGCGAATCCCCACCCATGTACGTAAACCTCCGTTTGCGGCGGAGGCGTCAGC
GCCAACAATATGTATGAATACCTGAGCATGCGCACCATCTGTGGTGCAAGGCCGAGATCCCTATGGTTAGCCATACGGGGGCGCTGTCCCATGCCGCATG
CGATAGCGGGACTAAAAATAGTCCTCCGAACCCCAACGGCCGGCTGTTTTCTGTTGATTTGCGGACTGGCGCTTTACTGTGCTGCCTCAAAAATTACTGT
CGAAGCGATACCCGCCCAGGTGGCGAGGAAGTAAAGTAATGCTCGTCAGCAACACGTGTTCGCAAGCCACGCGTTGCGCTTTGTCACGCGCACGCAGATC
ACTCGGCGCAACGACCGAGAGCGCGGTGGCGACTGCGGCGACCCCACAGCCATCGGACTAAAATCGGTGGCAATAATAGTACGCGAGGGGATGCTTCGCA
AGTCATGCCACACAATCTTTCTAGCCGCGCGCGCGGCTTTGTCGCCCAGTAATAATTTTATGGCGAGCAAACCGAACCCATTCTCCTATGGGGCTAGGGC
TCCTCGTACAGAGCAGGCCCTAGCCCCATAGGTGAGTGAGCGACGCTCACTCAGCGTTTGTGTTCTACTAGTACATGTTAGCATATGAAGATCGTCATGT
ATGGCAAGGTGACGGCCGTCACCTTGCATGTACATGTATGTAGCTGTGTGTGTGCAGCAAGTTGCGCCGAGAAGCTTGACCCTGTCCACCCTTCGCACTC
CGAATCCTAGATCACGCGTTTGGGATACCAGCCAAACGCGGTTATAGGGGACAATCTCGCTTTAGTCATGGAGCCGAACTAAAACTCTGAGTCACCCGTA
AAAATGTGTGCGTGCTCGTATATGTATTGTACGCTGACTTTTTCATGTGCGCAATAAGGCTTCCTCATGGTCACGCTGGACACGATCGCAATGGTCCATG
TGACGGTCATTCTGGTGGAAGTGGTGGACTTCGTGGAGCACCCGCTGGCGAGCAACCTCCCGCGCGAGTTCGCTGCCTTTTTCGTCACGGTCGCGTCGGC
CGAGCTGGGACACTTCCTCTTCGACGTGGTGACGACGCAGCAGCAGAGAGTCCGGTGCTTCCGGCGCTGGAGGGCGTCGAGAGCAGCAGACTTTATCACG
TCGGTGCTGTTTGGCGCCGCCGGCATGCTGG