Description :
From Genome Similarity Track
Location :
Scaffold_309:6496- 9424
Transcript NameFunction/comments
Phypl_g6783nardilysin, putative

Sequence
2928 bases(100 bases per row)
TGGAGGCTTCCAAGTCGCCCAATGACCAGAAGAAGTACcggctgctgacgctgcccaacgcgctgcaggcgctgctcatcTCCACagcggaggtggcgca
cgtggtggaggccgtggcgcgcgagagcgagagcgcgGGCCGCGACGAGGATGAGGACATGGACGACCAGAATCTTAGCGGAGaggacagcgccagcgac
ttgagcgagagcgaggacgacggcagcagcttcggcgacagcgacgaggagctcgagggcgcgcccagccgccgcgccgGCGCCTGCCTCACCGTGGGCG
TGGGCAGCTTCGCGGAGCCCGAGGCGCTCCCCGGCCTGGCGCACTACCTGGAGCACATGCTGTTCATGGGCAGCGACAAGTACCcggacgagaacgagtt
cgaggccTTTCTGAGCGCCCACGGGGGCTACAGCAACGGCGCCACGGACAACGAGGTGACCAGCTACACGTTCGAGGTGGGGCCGGCGCACCTGGAGCCA
GCGCTCGACATGTTCGCgcacttcttcatctcgccaCTGCTCAAGGCTGAGGCCATGGAGAGGGAGCTGTCGGCTATTGAGTCCGAGTTCAGTCAGGCTA
CCCAGAACGACCGGATCCGctcgcagcaggtgctgtGCGACGTGACGCCTCCGAGCCACCCGTACCACCGCTTCAGCTGGGGCAACAAGAAGAgtctgca
ggagctgccggGGAAGACGGGCGTCGACGTGCGCAAGCAGATCCTGCAGTTCTACGAGAAGTACTACTCGGCCAGCATCATGAAGCTTGTTGTTTGCGGG
GAAAACACGCTGGATGAGTTGGAGCAGTGGGTGACCAAGTCGTTCAGCTCGATTCCGAACAAGCAGGTGGAGGTGCCGTCTTTCGCGTTGGCGGGGCCGC
CCTTTGGAGCGAAAGGTTCTGGTGCACCGTTCCTCTGCAAGATTTCCCCTGTCCGGGACATCCACACGCTTCATCTCGACTGGATGATCCCGCCCGTTCT
TGGTCAACATCACCAGAAACCCGCGGACTACATCGCTAGCCTCCTTGGTCATGAAAGCGAAGGATCTGTGCTCTCCCATGTATGCCAACCAACTTGATTC
TTGTCGAATTGCCAGTTTTGTTGAGAACTAATACTCACGGTGCATGTTGAATGTattgcagctgaaggagcggGGCTGGATCTCTGCGGTGACCGCAGGG
GTAACCGACACTGATGGCTATGACTGTGGTACCTATGCAGCGAAGTTTGATATCACGATGAAACTCACGCTGGAGGGCATTTCCCACTGGGAGGAAATTG
TGCACGCAGTTTTTGAGTACCTGCACATGCTCAGGGTAAATGGATGCCCGGAGTGGGTGTttgacgagctggcggcacTGGCCGACATTTCGTTCCGCTT
CCAGGAAGAGGATAGTGCTGTCGAAAGGTGTGAAGAGCTGGGAGAAATTATGCAGGTAAGCACTCTTGCTACACCAGTTGCAAGATGTTTTTcttttgtt
gttgttttgAACTAACCATTTTTAAATGCATACAGTTGATGTTCAAGGTCGCACCGGAGGATATTTTGCGCTACGACCTGTTCCAGGGTGCCTTCCAGAA
GGAGCTTGCTGAAGAAGTGCTGAGTCACTTGGCCGCTGAGTCTGTGTGCGTCTCGATCGTTTCGCAGAAGTTTGAAGAATCCCCTGAATTTCAGGCACAG
GTGTGTAATGATACGATGGTCTCTGCTGATTCAACCTCTTTGAAATTGCTAACCCGTTATGTTTCGTCTTGTTTTATGGTAATAATAGGCCCTTGAGGAG
GAGTGGTTTGGAGTCAAGTACTCGCGAGAGAATATTACGGACATCACTATtcagcgctggaagagcgcaGGAGCTAACCCCAAGCTGCACCTGCCGCGTC
CAAACCAGTTTATTCCGCGAGATTTCTCGCTCGTGGATTCAACAGGTGTTAAGGACCTTGTGTGCGAAAAGACGGCGTTCGGCAAGCTATGGTACAAGCC
AGATCGTGTATTTGCTACTCCTCGCGCTCACGTTGCGCTTTTGGTGCACTTGCCCAGTGTGGTAGCTAACGTGGACAATTGGGCCCACACCCAGCTGTAC
GTGAAGCTTGTTCGGGATGCGCTTAATGAGTACGCATACCATGCGAATGTGGCCGAGCTCATGTACTCGCTTCATGTCAAGGAGTCTGGTCTGGAATTGA
TCTTTGGTGGTTTCAACGATaagctccaccttcttgtcgAAGTGGTGGTCGCGGCTGTGTTTGGAACGGAAGTCAATGAAGCACGTTTTGAAGTGATGCG
AGAAGAATTGATGCGCGAATCGAAGAACGCAATCACGAAGGTGGCACAAAAAGCGAAGTACCTTCGGTTGCAACTTCTGGAGAAGAACTCGTTTCCGCTG
GAGGAACGCTTGGACTCGATCGAGGCTGCCACCGTAGGATCACTCAAAAAGTACGTCTCAAGCCAACTCTGGGCAAACAAGGCATGGCTTGCCAGTTTTG
CGCACGGAAATATTTcccatgcagcagcgtcgcaAATGATCGCCAATGTCgaagcgcagctgcagcgtgtggctGCACCGCTACAGTTGCGAGACTTTCC
CCGACGCCTTATCAATGCCATCCCGCAGACCCCCATGGGCTTTCTGCTGAAGGAGCGCAGCGCAAACAAAACTGAGACGAACACACAGGTGGAACTCTAC
TACCAGATCGGTCCGTTGACTCTGCGTAGCCTGGCCTACGCGGACTTGTTGCACCAGTTGATGGAGGAACCATTATTTGACACTTTACGCACGAAGCAGG
AGCTCGGTTACGATGTCTCTTGCACTGTTCGTGTGACCAACGGCATTTTGGGCTTCGGTGTCATGGTTCAGTCGTCATTGTTCGCAGCGGAGTACATTTC
TGCTTGCGTTGACCGCTTCATGGTTGAC