Description :
From Genome Similarity Track
Location :
Scaffold_1613:6496- 7840
Transcript NameFunction/comments
Phyta_totarag13351hypothetical protein PHYSODRAFT_487500

Sequence
1344 bases(100 bases per row)
GATCAGAGCAGTGAACTCGTTGATCTCGGGCAACGAGTCCTGCTGTGCCATTGCCATATTCGACGGAGACAGTCGGCCTTGGTGGAACGAAAATGCCTCC
GTCATCCCTGCCTTCGACTGCAGCTTTGCGTACGGCATTTGACGCCAAGAACCGTCTTCAACGTTCCCAGGGATGCGCGAGAGGCTTGCACCTCCAGTGA
TGAAGTAGTATTGGCTGCGGACCAGCACCGTGGGTTCttcctcgatctgcagcaatCTCTCCTCCAAATCGATGTCGCTGGCGTCCAAACCAAAGGGGTA
CTCAATCTCCATGGCAACTTCGTCGGCCATGAAGAGAAAAGTCCCCCACAAAAACACCCAAATCGGCGTGTAGAGCCCGAGTTCGGCACGATAACAAACG
TGTAGAGCAACATGTAGGCCGCAAGTAGGAATTGCAGGTACTGCATGTAGTTGAAGGGGATCGGGACATTGGCAATATTGAAAACTGTCGTGTACAGATT
CGGCAACTGTGCAATTTTGATCTGCAAGTTATTGGCATTTGGCAGCGTCAAGTGGCCGCGTCTTGTAGCCACCTGGACGAGACGCTTAAGCCACAGCTCT
GTGATGGTAGCACGCAACTTGTGAGGCGTTCGGCGTACTAGAGCTTGATATGATTCCTTATCCTTGATTTGTTTCTTGTGCTCCGAACCGCACGCGTACA
GTTCGTCATACTCGGCATCAGTCTTGCCTGagtccttgagcttgtcaaTACCATCACGACCATGACAGTCGTGATACACGATAGCAATGTACAGGAACAC
GAGACGCCGCAGTCCCGTGAAGAATGTGCACTTCTCGAGAACATCCCTAGGAATCGGTTGTTGCTTGTGGTGAGCACCACCGAGTTGCTTACGTTTCTTG
CCGAGCTCGATTTCTTCCGCCACTGTCCGTCCAGCTCGCTTAGCTGCCTCAGCAATAGCTTCGCCGTTTGTGTCTCCTACGCCGcgttccttcttctctt
ccttgATGGTCGTGCTCACATACGCGCAACAGGAGCCAACAATTTCCCTCGCCACTTCAGATAGCGCCCCCATGGCCACCATACCAGATCGCCATTGCGT
GAAGGCCGAATTCAACCGGAACGAGATGATGAGGCCCAGGAACGTGTTGAACACTGTCAATGAATCCGTGAACGCTGTCGAGTTGCGGGTCGCCACCACA
AACGGGTGGTAGTGGTTTGTGGCCGCGACAACCATCGCAATCGTCGCCATGATCAGCGCACGCACCGGAGCTTGGCCGTTGAGTGCGGACCCATgccaac
gcagcagcaccccTCCACAACCTCGATGTGTCATAGTAAATCAT