Description :
From Genome Similarity Track
Location :
Scaffold_316:6495- 13870
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.11NADPH:adrenodoxin oxidoreductase
Pytul_var.sporangiiferummaker-pug3_contig_316-snap-gene-0.17Kinesin
Pytul_var.sporangiiferummaker-pug3_contig_316-fgenesh-gene-0.7Kinesin motor domain containing protein

Sequence
7375 bases(100 bases per row)
CTCGGCCTCTGACGTCACTGACACCGCGTTGCGTGTGTGCATTGTGGGCTCGGGTCCTGCGGGCTTCTACGCCGCCAAGTACCTGCTCAAGGAGCACGAC
GGCGTGCGCGTGGACATGATCGAAGCGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCACCCC
GAGGTCAAGTCGGTGATGAACGATTTCGAGAAAGTGGCGGCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCCGCGTCGGCGACGACATCTCGCTGA
GCGATCTCAAGCAGCACTACCACGCAGTGGTGCTCGCGTACGGCGCAGCGGGCGATCGTGAACTTGGGATCCCAGGTGAACACTTAGCGGGCGTGCTGAG
CGCGAGAGCGTTTGTGAACTGGTACAACGGCCATCCGCAATTCCGCGACTTACCAGTGGATCTGTCGGGCGAGACGGCCGTGATCTTTGGACAGGGCAAC
GTCGCAGTGGACTGCGCGCGCATTTTGACGAAATCGGTCGATGAGCTTGCGACGACGGATATCTCGCAGCATGCTGTCGATGTGCTTCGCAACAGGTACA
ACGCATTTTTTTCATTTATTATGCCTTTTGGGATGCTCATTGTGCTGACTGTGTTTACCCACCATGATGCAGCAACATCAAGAAGGTGTACCTGATCGGC
CGTCGTGGAAGTGCGCAAGCAGCGTTCACGATGAAAGAAATCCGTGAGTTGACCAAGCTGACAAACGTCTCGTGCGTCGTTGATCCGGCCGATATGAAGG
CCAGTCTGAATGAGAGCTCCCAGCAGGAAATCAACGAGCAACGCGCCAAGAAGCGCATGAACGAACTGTTGAGTAAGTTTCTTCTATTCTGCTGTGATTT
TATTGCGACTGCGTGCAGTCAGTCACACTCAACTTTTCAACTTTTTTGCATGTAGCCAAGGTTTCGAGTGAATTCGGCAAAGAAAGCACTGGAGCTCGTC
AGGTCCAGATCAAGTTTCTCTCTGCTCCTGTTGAACTGCTCGCGGATCCAGAAAACCCAGAAAAAGTTGGCAATGTGCGTGTAGAGAAGACCAAGCTGCA
AGGTGAGGCGAATCGCCAACGTGCTGTGGGTACAGGTGAGTTCGAGACGATTCCCGCTAGTTTGGTGCTACGCAGCATTGGGTACAAGTCGCAGCCGCTT
GAGGATGCTCCATTTGATACCAAGCGTAATGTGCTTGCAAACGACCAAGGCAGACTCATTGATGTAAAGGGTGATGGAGAGCAAGTCGTGGGTCTGTACT
GCTCGGGATGGGTAAAGCGTGGCCCTTCTGGTATCATTGGCACGAACATTGTCGATGCCCGAGAGACTGTGACCAGTATCGTCGAAGACATTGCGAGTGG
CAAAATTCTGAAGCCAGCGAGTTCAAACGGACTCGAGACGATCAAGCAAATCATTCTTGGGAAGAATCCTGAGAAACAGCTCGTGTCATGGAAGGATTAC
GAGCGACTGAACGATGAAGAAACGAAGCGTGGGGAAGCAGTTGGGAAACCTCGCGAGAAATTCACCTCAGTGGAAGAGATGCTGCGAATCGTTGCCGAAA
AGTGAGTCATCAATACGATTGCGACCCGCACGTAGAAGACGCAGCTGAATCCTGGATGACACCTTGAATAAGTCGATTCCAGAGTTTTTTTGGAATTTAC
AAGGCAGACTTCAAAATTGGGATAGATTATATACTTTTGAAGTACACGACGATCGAGATGGCCATTACAGTGTCAATGGCCCGAGGTCATTCGCTGGCTC
TGCCGAGTGAGTGCACTATTTGCAGCTTTGAGTGCTCTGTTTTTCTTGCGCTAGTGACATTGAGCAAAACAAAATATGTCAACATCTGGACGCGATTCGA
ACAACGGGCAAGACAAGTAAGTGATGTGCAACAAACGTATACCTCTTCCTCTAACAGGGACTTGATTTGGTTGAACTCGACCATATCGGGAAGTCCTTCG
CTGGTGCAAAAGGCCGACGGACACGACTTCGTCGGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTGAAGATATTTTCCTCCGCGTCGCTAGTGCC
AACGGTTTGATTCACACGATCGCGTAAAACTGAAGGGTACGTCGTTGTCTTGGATCGTCGAGCTGGAGCGGAAACTGGTCGCACTAGCTTGCCATCATCA
TGGGCATGTGCACGATCGAAGTGTTGCAGGTGCTTGTTCGTATCCGTTGCCACCTGAGTTGATTGATTGTTACTGTGAGTCGCTCGTCTCATCCAGAACG
GACAATGGACTAACTTACCAATGCTTTCAAATGACGCAGCTTCGTGGAGTCAGCAAGAATGTTCTTTGGCAGCAATCCACTTCTGCCAAATCCAGTATCC
CATTAGTAAATATGCAAGCGATCGCCCTTCATCTAAGAAGCATGGAACGCACCGTTGTCCATTCTCGACCACCTGCAGCAACCGCCCAACGTACGAGTAC
AACTCGACGCAGTCTTCGCGCAGACTCTGTGAAGAAGGCAAAGACGGATTTCGTGAGCAAGAATACCAACCAGTGTGCGTCTCGAGTTTGAAAGAATAGA
AAGGAAGCAAAGACATTACGTCGACAGTGCGAGCCGTAGTCGCGTGCAGTTGCTGCAATTTCCCATTTGCTGCATCCAGGTCTTCAGTTTTCTTTTTCAG
GATCTGTTCAAACTACGGATCCAAGATCGCGTCAGCTTTAACGTAAAGGTCCGTTTGACGCTACAAGAAGAAAAAAGGCTCGTACATGCTGTCGAATGAG
CGTGATCTCATCCTCTTTCGATGTCTGTAGTGCTGCCACGCGTTGGCGGAGTTTCTGGACGCAATCAATCCACGACCATCTCAGCATGCCCAAATCATGA
ATAAGCCACATATATGCAGGAACCAACATTACCTGTTCATTTTGCTGCTCGCGTTTCTTGGATTCGTCCACGGCGGGATCGGCACGCATGTTGCCGATAG
ACGCGGAACGTTTCCACAACGCCTGCTCCTGACTCTCGCTGCTCGAATGTGGGTTTCGACTGAGCAGCTCCTTGATCTCGGCGCGGTGCTTGGCTTCTTC
GCTCGCTAACGCGCGCTCATATTCTTTGGTTTTCTGCACAAGGTTATCTTCCAGGACTGCGATGCGCCGCCGCTGGTCAGTGAGTGCTTTCCGAGACGCT
TCTTTGTCTTTCTTTGCCTCGTTCTACGTTATTGGAGCCAAACGATGAGGACACACACACACGCGATTTGGACGCAAGGGCTCGTTTCTCGTACCACGAC
GATTGAGAAGTTGTCTTTCGCATTGGCGTATTTTTGCCGTAGGTGATCACGGTCTTTCTTCGAGATCTCTGAGCGGAGGAAGAGCACAAAAGTCAACGAT
GTATCGCAGTTACCGGCGCCATCCTTTGATCTGCTTAGAGACACGCACCATGCGCCTTTCGCGTTGCCTGGAGCTGTGACTGATTCGCAGCCTTCCGAGT
TGGAGAGAGGCTTAACGTGTCGCTGCTACCACCCCCGTCATGCGCACATTCGTCCCCTTTCTCGGAGAACACAGATCGAAGCAAGAGGCCATCCTATCAA
AGACAAAAAAGTATCAATCAGCCACAACAACCTTAGAGACGCAGAGACGCATTCATGCTACGCAAAGATGCCGTGCAATTTCAAACTCACGGCAAACTTG
ATGTCTCCCGTCTCGGTGATCTCTTCAGCGTCGAACCCCAGTTCGTTCAGTGCGAGTACGAACTTGTTGTTGTACTCGGTGCGCAGCCCTTCGAGCTGGC
GGCGCAAGACCGATACCTCGTCTTGCAATTTGCGGATCCGGCGATCTTTATCGGCAACAGAGCCATTGATGTGGTTGACACGCGGCTGCAATGCCAGGCG
AAGAAGATAAAACGATCTGAGTGAGGTGAGAAGAAAAGCCCAGAGTCATCTCGTGGATAAACTCACTTGGTTTTGAACCGAACGGCATCGATTCGCGAAT
TGCAACGTGCCGAGACACTCTTCGTAGTGCTCCTTCATGGGATGGATCGTCGCGAGCAAGATCGTAAAGCAATTGCCGCCTGCATTTCACACATGGGAGT
GAGGCGAGTGACTACGAAAGTGGAAGCAAACGGAAACAAGTACCTCTCACCTATGCTGTTCTGCAGCAATCGCGTCAATTTTGAGTCGCGGTACGGGATG
TAGTTGTACCCACTCTCCGGATCGAGCGACATGACTACTTTCCCCACGGCCGAGAGACTCGAGTTGATGTGCAGCGCTTCTTTGAGCCGCTGGCCGTCGG
ATTCGCTCTTCTTGAGCCGTTCCGAGCCCGCGAGGTCCACCATGTTGAGCATCCCGTAGATCACTTCGCCAGTTTCCTGGACTACGAGCAGCGCATCACG
CATAGAGTGATGCATTTGAATTAGCGACCGATTCGTCAATGATGAAATGAGAAGAACGGGAATCGTGAGTCTACCTACTCTGCTGGAAGATGTGGATCGT
GAACACAGTGTGGGAGCGGGACGACACCGCGTTCATCTTTGTCTCGTGGGTCGCACGCAGCTTGAGTCCCGATTGCACAAGCGCGTCGACTTCTTCTCGC
GACGAGACCGTGACCATCGCGAGATCCTTCACAAACACGTTCCCCTGCGCATCCTCGTGGATCTCAAAGTTCGCTTTCTCGTAATCGTACTCTTCGTCCA
CGCGCGGCGGATTCGAACCAAAGCTGCGTGCTCATATAGCGGCGCGTTAGTTCTTGCGTCGATACCACGAGCGGTGCATTATGGTAATGCAACGTTTGCG
TCTGTACCTCGATGCGCTCTCCGTGCGCTGCATTTGTTGCTGCGTTCGCCAAACAGCAAAGGTGAATTGTCAGGTCAAATTCAAGGCCAGGCCTAGTTCG
GGTAAGACTTGTACTGATACCGACCTGGCGTAGAAACCACTCAGTGCTACTCGATGCCTGGTACGAGATCGGACGCCCCGTTTTCTTCAGATAGCTACCG
CCGAGGCAAACAAATGAAAGTCAGCACACGTTCATCACAGCCCCGCAACATCGTATAGCAATAGAAAGAGGAGAAGATTCATTACTCTCGAGACAAATCG
CGGACTCGGTCACAGTAAATCTCGAGAAAGCTCACGACGAGTGTGAATTCCTAAGTTGCAAAAAAGCGCATGTTTAATTTTCAAGTTGGCACGAACAAGG
CCAAGACAAAAGAATGGACCAAAGACGTGCTTTGGATTTGTTGTCGTTGCGGTCGACAAACTCGAAAAGCGACTCGATGGAGCGCGACAGCAGACCAGCT
TTCTCGCCAAACTCGCCGAAAATGCTGCGCACAGAGTTTCGCACAACGCACAAGATACGCAAAGCTGCAGACTCAGAAAAAAAAACAAGTTTCTCACAAT
GGCGGAACGTATCCGCACCTGAACGTTTTGCCAGACCCAGTTTGGCCATAAGCAAAGCAGCAGCTATTGATTCCCTTGAGCGCATAATCCACGAGCGGCT
TGCTTGTCTACCCACGCACACATACCAACCCCGAGAAGTGAGCCAGCAATTTATATCGTGCACATGGTCCACATTACTCCTTACCGTCTCAAACAACGTG
GCTTGCGACGTGTCTGTCCAATAGATCTACGCAAAATGCACAAGAGTCAACCCAGAATCAACAGCACGAGAGCCACCAAACGCGCGATTTAGTTCTCTCT
CCGAGACTTAAGTATCCCAATTTCGAGATTTGTAAGCGCGTACATGATCAAAGCTAAACGCGTGGTTGCCATATTGCATGCTCTCCGTGTTCTAAGCACG
CACACAAAGTACATATTCATCCCATTTATGACTGCTGTGGTCGCGATAGCGAGGGTGAAAGACCGCACGGGAAAAACGTACTTTGATGACGATGTTCTTT
TGCGTGTCGCGGTTGCGCTCAAACATGTCCTCGGGCGGCTTTTGGCCATCGGCACACGGCCGTGCACGCACATACACCTGGGTTATCACGCAAGCCCAAC
GGCATTCCTTCATGTTCAGCGCGGTGCTCAGCACAGAAAACAAGATCAGCGCAAACAGTGTACCTTGACGTTGGCATTCGCGAGCAACCGCGTATAGTCC
GTCGTGACCTTGTGGTCCATGGCGAAGATGAGGACTCGGCGCACTACAAAGTCGCAATTCTGCGCGAAGGCACGTCACACACACAACGCAGGCAACACGG
AGGACTCCAGAGAGCACGGTCGTCAGCATGAACAGCGTCAACAGCGTTAAGCGTAGTCGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTCTTCACAGTCAGTCAACTGGGTACTAGGATACCATTTCGCGATCCCCTGTATACTCATTTGGGAGAGATTGCCTCGACAC
GAGCATGACAGCGAGCGGGAGCAGGAGCGCTGCACCTGCAGCACACCCGGAATCGCTTCGCGATGTGCTGACGCGCATCCAAGAGCTCAACGCGCGCGGA
GAGAGCAAACACCAGCAGATCCGCGTCACCCACTGGGTGCGCAAGCTCCAGACGCAGCCGATGTCGAACCCGACGTGGAGGAAAAACGTGCTGGAGTACG
CGACGACGTTGCTGCAGATGCTCATGCACGGGGTATGCGCATGTGATATCTTCATCAAGTTTTTTTGTTTTCCCTCAGATCGGAATCGCTAATCATTTTC
TACCATAGACTCTCGATGAGCCGTTTGTCAAGATGCCACCGCAGGGGCCGTTGCCAACGCTCCTTCGTCACCATGTTCGCCATGCGTTTGTGTTGTTGCA
GTGATGCATGTGGTCCATGGATGCACTGCATTTGATCAATTGGCGACCACTTTTGTCACGTAGGTCCTTCGCACGCTTCCAAAGAGTCCACTAGCTCGCC
AGAGACGACTACCGCTTGTGCACCATCACGACACCCACACTCGACAAGATGTGGACAACAGCACGCCGCCACTCGTAAGCAATCAATCTTGGTTCTTTCT
ACCGATTGTGCGTTGACTGTGCCTGCTGCTCTTTTTCTTGCTCCTTTGATCAAGCAGATGCAGAATCAGCAGGTCCAGACGAGCGAGAGTGAGGACCAGT
GGGAGTGGCAGCGCGTGTGGAAAGGAGCGTTTGAGAAGATGCGACTTGAGCTGCACGAGCACAAGCACGAGAACCACACGCTTCGAGTGCAACTCAAGGT
ACACCCAGCGCCACGACGAGTGTGCTCCAGGCACCAAATCCATTGATCTCGTATATGTTATGGATGCGCACGACACTGTAGGAACTGCAAACGGTGGTCA
AAGGCTACGAGAAGACGCTCGAAAAGGAAGCGGAGACCCGAGACGAGCTGCAGAACAAGCACGCGACCGAACTCG