Description :
From Genome Similarity Track
Location :
Scaffold_14:649343- 653738
Transcript NameFunction/comments
Aphas_H257_06268PREDICTED: serine/threonine-protein kinase ATR-like

Sequence
4395 bases(100 bases per row)
CGTGCTTCGTACCAGGCTGTGGGATCGCTAAAGTTGTTGAGGAACCACTGGTGAAACCGAGGGGTAAAGGCGAGATGGGTCAGTATCTTGGTGCGGTACA
CCAGAGTCATGTGGGGAATGTCGTGCGCGTACTGCTTTTGCATGTTCAGAAAAGTGTCTTTGATGTCCGTGGTGAGGCGCACGGGCTGGAGGAAGCCCTG
TTCGGTCTTGTAAATCTGCGATATCAAGTGCCGCATCGCGCGGGTGTTGGGTACCCACTCCATGAGCCCGCTTTCTTCGTTCAAGCAGATCACGGCGTAC
GTTCGAAGGCGGAGCTTTCGCTTGCGGCCATCCGTCTCTCGTTGAAGCAGCTTGTTCATGAGCGCATTGAACTCCATCATACGCGCATCTTTGCGCAAGT
CGCCGTGCTTTTCGCGCTTACACAGGAACGAGTACGTCTTGCCGTCCGTGCCCTGGACCTGGATGCGCTTGGGCTTTTCTTTCGTCAGCATCACGTCGGC
CTTGTCCCCAAATGACTTGATGTACACGTCGCTTTCGGGCAGGTCGCGTCTGTTGATGCTGCTTTGAATCGGGAGTAGCACCTTGGCCCGTACCCGCGAG
AGTCGGACAGGCATCTTCTTTTGGTTCCCCGGGTCAAACTCGGCCAGTTTGATCAGCTCTTCCACGAGCCGCATGCCTTCGCTCAGCGCGTTGGCCATAT
CCACTTGGTTGGAGTTTGTGAGTTGCTTCTGGGCGACTTTGAGGATCTCAATTGCCCGCGTCTTGCGCTGCATATTGAGCGACTGCGCCAGCCCCAGCAC
GTACCACATGGCTCGCTGCGGGAACGCCATGAGCACCCGCACCATGATCGCTTTGACGCCGTCGACGACCGCCACGTTCGGATGGCAGATCCGCGACGTG
ACTTGAGGAAAGCACACGAGCCACATGCTTTCAGGCAAACTGTGCAGCGCGTCCAAGATGATCTTCGAAATGTCTTGCATCAACCCATAGTGGTGTTCGG
ATGACGATGGAATGTCGAGGCGGTAGCTGCGCTTGGTGGACTGGCTGGCTTGCAAGATCTCACCAAACTCGTACCACAACGTCAATAGCCGCGGCAACGA
CTGAAACAAATACTTGTCTGTGCCTTTCAACGACAACACGTAGTTGTGCAGGACGTGGGGCAGGTACGCGTACGGCTCCCCGCTCGCGTCTTCCCCTTCG
CGGCGGTCGTTGGCTAGCAGCACTTCAAAGTACTTTGCCAGGCAAAAGTACCCCTTGGCGTAGTCCTTATCGAATGCAATCACGGCTTTGTACCGATCGA
TCACGTGCTGGCCTTGCTTTTGGCTCGACTGTTGCATGTAGTTTGTTGCCAGGAGCAGCATCTTGGCGTCAAAGTGATTGTCCGAGGACCGAGGGTCCAT
GATCGTACTCACGTCGATGGGAATCGGCTCCAGCACATGCAGCGCCTCGTACATGTTGCCGCGCTCGACGAGCAACTTGGCTTGTTCGATGATGGCGTGG
CGGTTCCCCAACGCTTGTGCGTGCATCACGGCGCTCTCGGCGGTGCGAAGAAGCCCTTCCTTTCGCGCCATCTTTCCGTATTGCAACCAGTTGGCCGACA
CAATGCTCCGATCTAAGTGCAGATCTTCCATCATGACGCGGCGAAGGGCCAAGATGGGTTCCTGGAACTTTAACGCTGGCGCCATCATGGCATCCCGACG
GTTCCAAGGACATTGGGCATTCCAAATGGCCGTCTTGTTGGCCGACGCTTTGGACACGAGATACCCTTGCTCCAGTTCATGCAAAAAGTGCAATTGGTGC
AGCAGCGGGTACACGCGCTGGTACGATTCCTGCGACGCCGCGGCCAACGGCCCCATGATGGACGCCCGCGCCTCGCGCAAGTGCACGTGCATGTTGAGCT
GGTTTTGGTGAAAGCACAAGATGGTTTTGGCAAACTTGATGCCCATCATGTCCTCGCTTTTGTCCAACTTGACCTTCATCGCGTCCGTCGTGAGCTCAGT
CAAGAGATCCCATCGTGAGAGCCGCCACGCACACTCCAACGCGCACGGGTACACGGCCGGAATGACCTCGGGGTACTGGTTCACGATACCCCGGACGTGC
TGCAGCGCGCCTTCGAGTCGCCCGAGTTGAATCATGCACTGAATGACCCCGGCGTACAGTTCGCTGCGGATTTCCACCTCAACGTCCGACCCGTGCATGT
GATGGATGGCTTGTTCATAGCACGCCAGCGCGTCTTCCCATCGAGCCAAATGTTTGTGTTCGGCGATCAAATGCTGCAGCTCCTGGAACGACCCCGTGGG
GTGGGGATGAAGCCACCGCCGTTGCGTTGCCAGCCCCAGCAACGCATCCGGCTCGTCGAGACTGCCGTACATTTTCTGCATCTTGGTGATATCCGTCGAC
GTCATCTGCACGTTGTTGCCTTGTTGGCGCAAGTGGCTCTCAAAGTACTGGATCGCTCGAGCATACGCCTTGATCTTGAATGCCGCGGACGACAGCAGCG
ACAACGGGATATCTTTGAGGAATTCCTCGACAACCTCCTTTTCCTGGTCGAACAGTTCGTCCATGTGTTTAGCCATGTGGGGCTGCTGGCTCAGCGCGAT
TTTCTTGCGCTGACTCGCCCATACCCAGTCGTTGAGCTCGTCCAGCATGGAAAACACTGTTTGCGCGCACTGGTGGTGATGGCTAGACACGGTGGACGCC
TCGCTGTCGACGCTGCTGTCTTCCTGCAGCACACTCAGAATCTCCTGCTTGACGAGGTGGTACGACGCCGACTGCTTGAGCACGTTTTGCACCAGGTACG
GCAGCAAGAACCGAGCTATTTCCAGCGAAATCGTCAGCGCGCGGCGACACGCAAGGAAGATGTGGCGCTCAGGAAACGTCGAGTGATCGATGAGAAACTT
GCACCACGACACGAGCCACTGGTCAAATGCGACGGAACCGAGCGCTTCGTAGAACGTGGACGATGGCGGCATGGTCGTGGGCTTGAAATTCGGCGCCTGG
TACTTGGTCGACCAGTACGGGGCGATGATCTTGTCGACGCCTTTGCTGTGGAACTGGCGCTGCATCCACTCGGGCATCGACGACGACGACGGGACAAACA
ACACCCCCGACGAACTGGCGGCGGTCGATGAACTGCTGCTGTCTGGCGCATTGAGCTGCGCGAGGAACTGAAGCAGCTGCTGGATGGACAGCGCGATCAC
GTCCGTGTTTTGAGGGGCGGCGCGTAGTTCGTTGACAAGGAGGGTTTGAATCAAATGGCACGCCAGGTTCTTGGTGCTCAATTCATTGGTTGTGATGGGG
CGCAGTGCTTGGGGGGTGATCCGAGCCATGTCGATGGCCCCGAGCGCGCCGAGTGCTTGGGCAACCAAGATTTGCATGTTCTCTTGGGTTTCCAGTCGAC
TCAGGCGCAGCAGTTGCTTCAAAATGCCCATGATGCAAGTATGCACGACGCCTTCTTCGAGGGACAAGACCAAGTCGAGCACTTCGCGACTTCGACTGTT
GAGGATGTGGATCAAATGCAGCAGCCCCACTTCCCGCACCGCTCCGTCCCAGTGCTGCAGGAGCGGAAGCACAAGAGCCAATACTTCGTGGATGGGCAAG
TGTTTGATTGTTTGCACGGGGAAGTCGTTGGCCATGGGAGTCAGCGCCAGCACAAACGTCACCGACGGGTCGTCGTCGATCATTTCGCTGGTAAAGATCG
AGCGCAGCACGTCCAGCGCCACTTGCTGCGCCTCTGAAAGCGGCGGCGTTCGTGTCATCTTGTTAGTGTGAATCGTGGTCTCTGGACCCTCCACCACATG
CCGTTGAAATAGCTCGGTCAACGGACCAACGCACGGCAACAAGCTGACAACGATCGACAGCACGTTGGCTTTGATCGCGTCCGGGCTTAGCAGCCGCACA
AACGTACGCCATGCCCGGCACGCGGCGAGAATCTTGTCGGCGTGGGCTTCCACAGACGCCAGTTTCAACGTTGCCATGATCTTGGGCACAAAGTTGTCGA
GGGCGCCGACTGTGTCGAACAGAGACAGCAGCACTTCGGTGCACTGGATCGCTTGGATGCTGATGCGGACGTTCTTGGAGAGCAGCTTTTGGCCAAGGAA
TGTCATCACGGCCAGAAAGAACTGCTGGGAAATGTGAAACGTGTCCATGTGGTGGTCTTCGTCGTCGAGAAACTGCTTGCATACTTCTATGAACGACTTC
TTGGCGACTTTGGGCCGGTCGCCGGCCAGTTCCCACGCCAGCGCGTAGATGATTGTGAGCGGTTTGTGCTGAATCACGTCGCGGATGCCCACGTCGTGCG
GGATAAACCCAAAGAAAAACTCCCACTCGGCCACGTTGTTGAACGACGTGACTTTTTGCAGCAGCATTTCCTTGACGATGGCCAGGATGTGCTCG