Description :
From Genome Similarity Track
Location :
Scaffold_1048:6493- 8253
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1048-snap-gene-0.7Leucine-rich repeat-containing protein 56.

Sequence
1760 bases(100 bases per row)
GCCACGTCGACAAAGGCCTCTCGTACCCCGGCGACACTCCGAACGACTCCTGCGGACGTGTTGGGTCTTCTCTCGGCCGTGGGGACGCGAGCCAACCCAC
TACCACCACTACTGGGCGGTCGCTTGGTCGGGGAGCTCGACGGACTGATGATTTGCGTCGGGTCGTCCATCGACACGACGCCCACATTGGCCGAGCCGGC
GGCTTCAAGTCGCCAGGCCTTTAGTTCGTGAAGAATCGCGTCGCGTGACTTGTGCTTTTCAAGCTCGTTGGCGCGGTCCAGCGTCGCCGTGATTGACTCA
CGTGCCGGTGTATGGGGTCTCTCAATTATTGGATACCGTACTGTACCGGCGGCACCAGCAGCGGCGTTCGCGAGTGTGTCGCCTCCACCTTCAGTCTCGC
TTCGGTGGCGACGCAACGCACTCGTGACATTGCCTGCAAAGACGATATCCGTGCCGTGGGTCAGTGTGCTGCCATAGTCATCTCGTCCTCCTGAGTCTAA
CGACGACGCGGTGGAATCTTCTGGCCGGCGCCCATGGGACGACTCGGGTCTAGCCGAGTGCGGTCTCGCCGCAGCGGCTGCCTCCGTGTCCAACTCGTCT
TTTAATCTCTGGATTGACGAATCCACAGTCTCGTCCGAAAGCTTGGCGCGGTCCTCAGGGCTGATGGGTTGGTCGTCCAGCGTCTCGAGCTGCGGCAGGA
AGTTCGCGACAATTCGGCGGTATTGAGAGAGCCGGCAGAGCGGATTGCCGCGCAGCGTAAGCGATGTGAGCTGCGGGCAGTACACTGGCGTTCCATCGTA
GCAAGATGACGCAGTCAGTACCGCGTACAAATGCCGATATGCAAGACGGTGCACGTACCGAGCTGTTCGATTTGGCCCACGTCGGCGATCCGGTTGGACT
CGAGATCTACAGTTAAGTTCACAGCATACGCTGTCAACGGTCTGCCTCTCATGAAGCGTGAGAAAGCGAATAGACACGCACCCACGAAACGTAGCTCGTC
ATGCATCGTGAGCGGACTAANNNNNNNNNNGTACGCTGTGAAGCGATCTGCCTATCATGAAGCCTGAGGAAGCGAACGAACACGCACCCACGAAGCGTAG
CTCATCATGCATCGTGAGCGGACTAATGTCGCTCACGGCGTTGTGCTGCAGATGCAGTTCCTGCAGTTCCGTGAGCGCGCCAATGCCGTCGAGTTCCGAA
ATGCCGCAGTGCGCGACCCACAGGATTTGCAGCGAGTGGAGCGAGGTGCCGAGGTCACGAAAACTGTCGAGTGTGCTCTGCGGCTGGATGCGGAGCTGCT
GCAGCGACGGCAGCAGCTCCCCGATCACTTCGACCGACTGCCTGCGAGAATCCACCGAGAGCTGGAGACTCGTGACACGTGACAAGTCTACCTTGCCCGT
CAGCTTTTGCTATGCAGACAAACACACCCAATAAGCTACTGCATCGTCCACAGTTGCACCCGCCTGCTGCGTTGTGTCCGTACCAGCTTCTCTTCTGTGA
TATCATCGAACGGATTCTCGGTCGTCTCGAGCGGCTCCTCATTGACGAGCTCTATCGCCGCCGACGGCTGGCGGGTCTTGGGCGACAGCACCACTGGCGT
AGCACTGCCAGTCGCGGTGGCCTGTGCTGGCATCGGGTTGCACTCCTTGGGCAGCGTGCGGACCAGCAGCTTGGCCTTGGCGCCGCTACGCAGTGGCGTC
ACCACGGCAGCGCGCGTCTCGTCCATCTCGTCGCGCAGATCGACCGCCGCGACCATACTC