Description :
From Genome Similarity Track
Location :
Scaffold_138:6490- 7877
Sequence
1387 bases(100 bases per row)
CGGAGAAAATAAAAGTAATATACTGATGTTATTAGCTCGATGCACTATTCCTTCATATACAAAGGCATGTACATGCCATATAGATTCTGGGGGTGATATG
AGTGACGTCATCTGGATGATGTCCGACAAATATAGAATCGTCCATCGGAAACTTGCATCATCTTGGCATGTCAGTAGGCCTGTTACTCGCCCCCATGCTA
GTTTACGCTAGCAGGGAAACAAACGTCGGAGTTTCACTCATTCATTGACTGCTCCGCAATCAAGTGTGACGGTCCATTGGTGTGCACTTCCGTGATCGGA
TATGGTCCTGAAGCCGCTGCTCAGTGCTTGGTTTGTGATCCTTGGCGGCAATTCGCATCATGCAATGATCACCGACGTTGTAGAAATGTTCCAAACGAGA
TTGATCTTGACGATCATTTTCTCGCAAAATTGTGTCAAACCGCCGCTTGGTAAGAATGTTCCAGTTAGCTTCATATAGCTGTCGGTTTATCAGATCTTGT
CCGAAAATTAAATGCGCTGGAGTTGTACCGAGAATGCTGTGGTAGCTTGCTCGCACTGCAAACGCCGCGTACTGAATCACCTTTCGCCAATCTGCACCAT
CGTGACAACGGACACAATTGTTCAGTGTTAGCTGAACGCGCTCGCATACAGCATTTGCTTGGGGGTCTTCGCTGATATTGGTCTTGCCTTTATTGCGTAG
CTGTTAAGCATTTTAATAATTCTCGTGTGCTGAATTCGTTCCCGCGGTCGAACACGACGGTTTTTGGTCTTGAATATCTACATAGCCATGTCGCGTCAAA
ATTCTGGTCTGATGTCAGCCCTTGTTGTCCGACTGAATAGAAACTTCGAGCCACCGCGTTGCTTCGTCAACCACGGTCAGTGCATAACTACGATCGTTGC
CATATGGTCCCATCGTGTCAACATGTACCACATCAAAATGGTTGATGGTTTGAAGGTCACGAGGAGGTAAATTTACCGTATTTTTGAGGGCCACCATGCA
GCTTGGCACGCTTGCAGATGGCACATGCTCGGAAAAAATCCACAATACCGCGTTCAATGCCTGACCAGTAGAAAGTTAGTCGCGTTGCATAATATTTTCT
TTTTGCTCTAGGGTGACAGAGATTGGCGTGGTACCATTCCAAGATTTCGTCTCGCAAGCCCGTTGGAATGACGACTCGTTTTTGGTAGGTCATCAAGCGA
GCTCCCATGACATTCATGATCTTGTAATCAGGGTCTCTTGTGGCTTGGACGCAGCGATGAGCTAATGCTGCGTCCAAGCCACAAGCGACTCTATCTTATG
TTGCTGAGAACATAAAATTGTATAAAAAGGCATATGAAGTCACTCGCCTCTGATCTTCATGATAAGATGAGGATTCCGCTGAGCTAG