Description :
From Genome Similarity Track
Location :
Scaffold_101:6489- 12501
Sequence
6012 bases(100 bases per row)
CATGAATGCCCTTAGAGATATTACCTCCAAGGCCGACGTTCGGTTAGAGCGCAAACTGCGCTATTAATTTGCTAAGCTGAAGGCCAAAGGCCAGCTACGT
TCTCTGTATCGCAACCAGTATGCAAAACCAGTTGCTGGTCAAACCACCCTGTTTTGACTGTGCGGACAGTCGCGGGTCACTCGGTATTGACGAGCGACCC
CACACCTATTGGTCGGAAACGCGTTGGGGTGCATGCTGACCCTCAGCTCGACGCTCAAAAACGTCAACGGCGTACGGGCAATCTTGCCGAAGGGGTACCT
CAAACTCCCATGAGTTCTCAGATTCAAGGTATCCACGCCACTTCACCAGATACTGGTATTGACCTTTGTGACGACGCCGCTTCAGAATTCTCTCTACATG
GAAAGGTAATCTCCCTTGGTCGTCGAGAAACGCATGAGGGGGTCAATTTGTCGGCACAGGCTCATGAAGACTTTGTGTCAGAGGTGAAGCGACTCCGAGA
GTCTTTTGCTCACGTGCAGACGGCACTGGATCAGTCTGTGACTGAGACGAAACAACTCCGGGAGATCCTCTACCAAGTGCAACGCGCCCGTGAACAGTCC
TCGACTGAGTTGGCTCAGTTGCGTGCGCAGATTAACCGTCTAGACTCTATCGATTCGGTCGAGAAACGAATGCAGAAGGTGGAGTACCCTGCCTCGACTG
AATGACCAGATGGAACTCTTGATGAAAATGCATTTAACGGGACGACATCCCTCCTTCAGGCGCCAGCGCCTTCCGGTCCACGAGAGAAGGATCATGATAT
GGCTTAAGCAAGCCAACGTAAAACACTGGGTGTGTGCGCAACTTGCGCGGAAGATTGAGAGTATAGGCGATGCCCTTCTTCGCTATGACCGTGAGCGACC
CAATGAAGCTTGGGCGCAACTTTGTCTTGAAGACGGAAGATATTACATTTGTAGGTAGGTTTTTAGCATTTAATAAGACTTGGTCTCCAACTTCATAAGA
ATCAATACATCCTCTGCCTTTAGCATCAGCTTGTTCTTTTTGTTTGTCCTGGCTATCATCCATTGCATCACGCACATGCCTTAAGACACTAAAGCGCGTC
GTGAGAAACTCGCTCACTTGTTTTTGCATAGTGGTAGGGCTGATTTCAGCAAGCTTGTCAGCAGACTCCCCTCCACCAAGCCCATAACCACGGAGTGGTA
ACGTGAGCGGAACGTGGGGGTGCGTGAGGCTATTCACATAAATGGGAGTAAAGCCGATCGAGGCATGAACAGCGTTGTACAACGCAAACTTAATGACAGG
GAGCATCGAGCTCCAAGTCTTAGGCGATTCAGCAAAAATACTACGAAGACCGTCACCAATGACGCGATTAACTCGCTCAATGTGACCATCGGTCTACGGA
TGGTCCGCTGTGGACATGTCCAATCGCGTGCCAAGCACCTTGAAAATGGAAGTCCAAAACTTGCCAGTGAAGCGAGGGTCGCGATCAGAGATGATTGACA
GCGGCAACCCGTGTTGACGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACTGCCGCTCAGTGAGCCATCTTACT
TAAGCGGTCAACAAAGACCACAAATCCCGTATTGCCTTCACTGTCTTTGGGAAGACCGAACACAAAATACATACTGATGGACTCCCAACACCCCGTGTGC
ACAGGTAAATTGGTGAGTGTCGCAGCCGAATGTGCTGAGGGTTTGACCTACTGGCACGTTTCTCATGTACGCACGTATGTGTCCACCCATTTGTAGAGTT
TGGGCCACCAGTAGTGTTGACTCACAGAGCTATAAGTCTTTTCCAGACCCAAATGCCCACTGAGGGCAGTATCGTGGGCCTAAAAGAGGATTCGATACTT
TAAATCATCATTGTGAGGCACAACAATGCGAGTGGAATCCGCTACGTCTGTGCAATAACACAAGAGGCCATTATCGATGGAATATCGATGCAGGCTATAC
CGCAAGCGTGCCGATAATTGACTGTCCGAGTCCTTGTATTCCTCACTTTCAAGGGCATGAAACAATACCACACATTGATTATCCCGTGGATAGGCCACAC
GAATGATCTCCTCAATAGGAGACGACAAATTCGTGACATGAGCAAGCTCATAACCATGTCGGCGAGAGAAGGCATCCGCCCACACATTTTGTTTGCCTGG
CTTATACTTCACCTCAAAGTTATATTCCACAAAGAAGGAAAGCCACCGAGTCATTCTCTGAGAGAGGTGAGGTGACTGTATCGCCGTGCGTAATGACACA
TGATCCGTATAGATGACGAATGACTTGGATCCAAGCAGATGGAATCTAAATTTGACGAGCACATACTTCATAGTAAGTAGCTCTTTGTCATGAACTGAAT
AGTTATTTTCAGCAGCTTTCAGCTGGCGTGATTCAAATGCGATAACTCGCTCGCGGCCTGCAGCATCTGTTTGTAACAGAGCGCTTCCTATAGCAAAGTC
GGATGCATCGCAGACAACACTGAAAGGGTACTCAGGATTTGGCAACGCCAAAATGGAAGCAAGGAGGAGACTCACCTTTATTGCCCGAAATGCGTCGGCA
GGGGTATTGTCCCAGAGCCAATCGATGTCCTTCTTAAAGAGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGG
CAAGGCCAAGCCACTTACGCAAGTCCTTTTGATTCTTAGGAATCGGCCAGTCCACTATAGCTTTGACCTTAGTGGGATCCGCTCGAAGGCCGCGCTTACC
ATAAAACAGCCGAGAAAAGGAATCTCTGCTGCATCAAAAATGCATTTAGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTCGCA
AATGACTGATGTGATTTGTAACATCTGACCGACCTTGTTCGGCACAACTATGGACAAAAATATCGTCAAAGTACGTATGTGCGTAATCCCTATGTGGGAG
GAAAAGCTGCATCACTAGACGATTAAATGTTACCGGAGCATTAGACAGCCCCGGGGCATCACCAGCCATTTCCATAGCATACCACTCGGAGTGCTCACTG
CCGTAAGCAGAATATCACTCACTCGCATGAGCAATTAATAATATCCATCGACCAAGTCGAGTGCACTATACATAGTACAACCAACCATGTTGTTTTGAAG
AACACCCTTTCGAAGAATCAGTGTCTGTGCCGGAATAGTAGCCGTATTAAGCTTGTTATAAGCATGCACAACACGCCACTTGCCGTTCGGATTTTTGACA
CAAAATGTCGGTGTCGAATGTGGAGATTTACTCCCACGTACCATTCCTGCCTCGTGCTTGGCACGGAAGAAGTCATCAATGACATCACATTGCTCCTTAG
GCAAGGGCCACTGTCGTGTGACACAGTATTTAGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGGTAGAACAGAGGGTGGATCGTG
ACACCACATCTTGAAATTAATTGACTAAGGAATAAAAGGGATCATGAGGGGTTTTCAAAATTGGTGACACACTACGCCCACTGAGTGCTGTTTTTGTGTC
CTCCAGAACGGCTTCATCCAAAAGTGAAGAAGAGTTCAACTCTATGATTTCGGGTCAAATGACCACCACCTCTGAAAGGTCTCCATTCTTTAGTGAGTGA
TCAAACTCATCGACCGACAACTCCTCGAGTTCTAAAAAAGAGAACTTAACGAGGGTATAGCCTCAAGGCTAATTGTACCATCACAGGCACCAGTCACTCC
GTTGACGACTGTATACAGCTGACAGTCATCATCACTTTATGACACAGCACACGATGTGTGATTCGTATCTCTCTGATCGATACCATCATCGAACGTAATT
TGCTCTAAACTAGAGCTGACGTCACTATTGACATCCGATGACGAGTCATTGGACCTGAAGCCGTCATCACGTGGATTACATGCCACTTCACGTGGATTAC
ATGCCACTTCACGTGCATCCGCTGAACCGGGCTCGGGATGCCTTGGTATTTCACCAACAACGTCAATATTAACATTCAGCGCGTCGCTATTACAGTACAA
CATCACTCAGTGGGTACTTACGTGCCACTTCACGCTCATCTGATGGTTTCAACCCTCGATGACTTGACGCTTGGTCAACAATGCTTTCAACATTCAGTAC
GTTGCTCTCACAACGAATATCACTTAGCGGAGTACGTGCCGCTTCAATATCACATATCGAGCTTTTTCTATAGTCATATCTTTGACATCTTTAGAATCAA
CTAACTCTTACATTCCGATGTCCAGCACACTGACATTTTCAGCCAGTGGCTCGCGACAATAACGCTTCTAATTACTAGCAGAGGTGGGTTCATGACTCTC
CAAATCTCCGCTAGGGGCAGTGCGCGTGGCGCCTAATATTTTTCGACCTCCAGTCGATCCATGGATCATGGCGCTCAAGCCAAGCCATACCAAGAATGAG
ATCACATATCGATTCCAAATCAAGGACTAAACAGCGTTCGATACTATCAAAATCGAAAAACTTCACACCCATTTCACAGAAACTTTGGGTGCGGTGACTA
GCGTTCCTATCGCCAAGCGAACAGTGATCGTATCAATCCCGTGTGATTCTAGCGCCCCAACATAACGTCGATTCCATTCAAGGGAATAGCATCTGACATA
ATTACCGGATGCTCCGGAGTCGATCAAAATCGAACAGGGTTTGTCAAAGCCCGTAGGAGTCGCTTTTGCGACCAAAAAGCCTGGCTTGTATTCACACCCC
GTGTTAGAGTGCACGGAACTCCTTGGGACTAAATTCTGCTCGCCACTACCTCCTAGAGGCTCAACAGAACCTAGTCCCTCCCTACGTTTTTCCGCACCGT
ACCAGATTTCTGGTTAGCGGCGGGAGTTCGGCCTGAAATAGCTTGGCGTGCCATGTGTAAAGAGCAATTAGATCTCAGATGATTTGTGCTTCCGCACGTG
AAACATCGTCGAATGTTTCGATGCTGTTCTACTACCCGAAGCTCTGCCTCTTCGTCCGTCTCGGCGAGACTGAGGTCCATAGGCTCCGGCCTATTGAATG
AACTAAATGAGTTCTCCCAGTTTGGGTTGTACCCATGGGTGCCAAAATGGGCTGCCTTAAAGTTGAACTCAGCGTTCAACGCGATATCCACAGCCGCCTC
AAAGGAGGTGGGGTGTTACCTGGAATAATTCCGTTCGGGCCACGCCCGTCTGAAGGCCCTCCATGAAGATGGTAACCAAAATCATTTCTAGTAAGGAATC
AAGCTGCATGGCAGCGATTAGAGTTCTCAGTTCCTGGATACAGTCCGATAGTTCTTTCTTGCCCTGACGGGAAGATAGGAAACGAGAATGCACCCGGTAT
GCCTGATTAGGCGGAGCAAACACCCAGGATATTTGCTGTTTTAGCAAATCCCATGTGAGGAAAGCTTCGTCTGCCGAAGTGCTACACGTGAGAGCCCATT
CTCTGGCTCGACCACCTAGTTTCGAGATAGCCATCCCAACCGCTGCTGCTCCGACCGGAGAATAGCGGAGTTCATGGCCATTTCCACCTCTCTGATCCAC
AGGAGGATATTCTCCCCTTCTTTTCCCTCAAATGTCTTTACAGTCAAGTCAAGGGGGCGAGCCCTTGGCTCTTCATCGTGTACGGGGACATACCGAGTAG
GCATAGCCGATGCCAAATGGTCGTGTACTTGCCCAATCAAAGTGGAATCAAACTGCATAAAATCGTCAAGACGTGCAAAAATCACGTCAGGACCTTGTGC
GAGGACTAGATTCACTTGTTCGTTACCGACTAGCGCTCTGAGTTTTTCCAGCGCTAATCCTTGGGCCTCAGAGAGGGTTAGATTGGTTTCCATTTATACA
GAGGAACAGTCTTTAACAGACTCAGATATAGATTGACTACAAGTGCTACCAAGTGTAGCGGAGCTACCCTATCTCGTTAGTCAGAGGAAGACTTCTAGAC
TCTTAGAGTCTC