Description :
From Genome Similarity Track
Location :
Scaffold_317:6489- 7565
Sequence
1076 bases(100 bases per row)
ATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTC
TGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCACGGAGTCAAATGTGACATCGATGTCGGCGA
CGCGAAACTGATCGCTCAGAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAACAATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGT
TTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATTATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGA
CTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGTTGTCTTGATATGGCCAGCAGTTTTTG
GGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCA
CCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCGAATACCGGAACCCGAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAG
ATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGA
TCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAT
TACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGCTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGC
AATCCTTCTTGGGCAGTTTGAACTACTACAGCCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGA