Description :
From Genome Similarity Track
Location :
Scaffold_9:64884- 72666
Transcript NameFunction/comments
Physo_129740DBP2 (DNA POLYMERASE EPSILON SUBUNIT B); epsilon DNA polymerase
Physo_129741hypothetical protein

Sequence
7782 bases(100 bases per row)
TGGCTTATTCAACACGGCTGAACTCGGTAGTGTTGGTGCTTGGGCGGTAGAACACAAAGGAGAAGTCTGCGTGGAACGGGCCTGGGTGGAAGACGCCGAC
GGACGAGTAGCCGAGCTGGTACTGCTCGGTCGAGTCGCCGAGGATCAGCACGTCAGGGACCGGGAAGAGCTGCAGCGAGGAGTCGAAGTCCCAGTTGATG
GGATTCGCCATCAGCGGCAGCGGGCACAAGTGCGCTTGGTCGATGAGCGTCTTGGCCAACTAAAAGTTCGTAAAGCACAGGAGTCAGCAACAAATGTCAA
CGATCGACCACTCTCAACCAGGCAAAAACACTGCGTCGTACATGCTTGGAGATGTCGGTTTGAGAGACCGACTGCGCTGGCTCGCCGCTTTCGTCCATGA
CGGCTTCCTCCTGCTCGCTCGGCATTGGAGTAAGAATGGCATGCCGCTGCATTTTCTGCTGGAGGTCGTCACGGAAGATCACGATGTCTTGTGTGTAGTA
GCGGATTCGGCATGGGTTGGTGCTGCACGTGACGTTTGGCACTTTTCGAATGAGCTCACGTGTACACAGATCGGGAAGCTGTGGATACAACATAAGGTTT
AGCTTTAAGGTAGCATAACAAATGCCGTGCTGCACTTACCGGGTGGCGCGGGAAGGCACGAGATGAACCGGGGTCGTTCGGCCCTGGAACTAATACGAAC
CGCGAGTTCTCGGCGATCCCAGGGTACTTCAAGATGAGGTTTCCCAGTTCCTCCAAGTACTCGCGCAGGTCTTGAAGCGAGTTGGACCCGGCACCTCCTC
CGATAGAAGTTGACATGAAATCGCCCATGAGGATGAAGAGCGTCGGCTGAACACTTTCGAGACCCTGAAACAGTTCGTCCAGCTTGCTCATGACCTGAGG
ATCATCCAAATAAACGGCCGACAGCACGATGAACGTGGCGTGATGGTCGCTGGCTTCTAACTCTCGAATCTGTTCGCGTTGTTGGGCAGACACCTCCACA
CCAAGCGGATCGATACCACCGAGAACTTCCAAGGACGCCTCCTTCGTCTCTGGGGGCGGGAAACCCATAGACTAGCCCAGCAAGACCACATTCAAATATC
AGCAAAACAAAAAACCTGAAATAACCACTATCAACACAGCTCTTACCTGAACGTGGAGCACGTCGTCGATGACTTCACCTTCCACCAAAACTACACAGTT
GATCGTGAAGAGTCCATCGGTGTACGCGGCATTCGTAAGGTCCACAATGATTCGCGAGGTGAAGTCTTCCAGGTAAAACCGCTTGCGCTCGTCCTGGCCC
AGCATGCCAATCACGCGGCGCACTCCGCTCACACCCAACAGCGACTCGATCCTCGACAACTACAGTATCGTAAGCATCACAACAACCATGTGAGTCCACC
TCCCAAAGTTTATCCAGCTCCAGGGTTAATTCAACCGGCCCACCTCCATGTACTCCGTGGTGTTCGCCACAGCAACCGAGGGCGGCGCGAAGAGTCGATT
GCGCTTGACACGGAGGTCCACCGACATGAATCGGTTCCTCAGCAGCTGAATCCTGGACTCCGGGCCGGCATGAAGACGCCGGTGGGCGTCCGCCTTCAGC
TCGTAGGAATTGTTGTGCGTGTTGAAGTGCAGCCTCGGCGTGTCGAAGGCGCCGAACACTTGGATCTGCTCGTAGTCGTTCTCAGCGGAGACAGCCAGCA
GCGTGTCCAACGCGCTCTCCAACGCCTCCAGCGTCACCACGGACGTCGTCACTGAGAATAATAATAAAAATCAATAATTAGTCCTATGCGATTGCTTTTA
CTGATTTTAAGAGCGTAGACGCACTCTTGCTGCGGTCAATGTTGTTCTTGATGGCGTAGAGAACATCTTCCAGCTGGAGCGAAGCCTCACTGCGAAGTAA
AACGGAAGATATGGGGCATGGCGTTAGAGAGAGTGCGTAGGTGGGGTCGCTGGCTTTGACGTGGTATTTTGACGCTTCTAGTGGGTGTTGGGAAGTGCGA
ATTAGATGAATTGGAGTGCAAGACGCATACGCACTTATTGAGCTCTTCAGTAAGTCGCCGCAGCGCGTCGGCATGCAGCGACAAGCCCTGCAACTTGCAC
GCGCGTAAAATCCGCTTGGACGCCATGACTGTAAAAAGTTTTCCCGCGTTTTTAGGGAAACCGTGAATATTGTATCCATGTACCGTTTAACTGGTACCAA
TTGACACGGATGGCTACATAGTGTGCAAGTTGCAACTTGCAAGGCTAGGTAGCTCTAAGAAGCAAGTGTATTATCCGAAGGATGCAGTCTCTATATGGGC
AGGAGGAGGTAGAGGTCTTGTAAACGTAAAGACACTCGTAGCCTGATCACCAAAACTTGGAAGATTAGAGCGATACCGCCTAGTAGGTTTGGTTGCCGCC
TTGGCCCAACCCCAGTACGTAGCTCATACCCTGTGCGTCGCGAACGGCGGACGCATCTCCCATCGCCGCCGACACGCGCGAGAAGGTGTTCCAGCACTGC
GCACTTTGTGGTCTCGCACTCAGACTGGAAATGCAGCAATTGAGGAGTTAGACGCCATGGCATGAAAGCAACAACTGGGCCTCAAATGAACGTACCGTTC
GTTGAGAAGGAGCTTCGCCAGTCGCAGATCATTACATTTACTAGCACTATACAGCATCAGCGAGTGAGGTGTTAGCAAGCAGGACGACTTATATCGTAGC
CTTTAGGACGATCCGTACCACTCGATAAGCAGTTGCTCCACCACGTCTTGGTCCACGTCAGTGCCGCCAAGAAGACCAAGCTTTCCTCGCACCGGCAGCA
GCGCTTGAGTTGCATCTTTGAAACGCGCCTACATATTTGCAAAACAAATTCGTCACCACATGATAAATTCCTATCGTTGCCAGCAGAGAGAACGCGGGCG
GCATATACGATACCTCTGAGTAGGCTTGAAATCCTCGGCACACGCTTTGGTATACCTCTTCCAATTCACCTGTATACCATAGCCAGAAGAGTGATAATTA
GCATTGCTCAGCAAATTCAACTATGTCCGGCAACGGACCAGGAAAAGCAGGGTAGCTGAACTGGAACGGGGTAAGGCCCAGCTGAGCCTCCAAGCGGGCA
GTATCGACAGCAGGCTCCGCATCAAGCGGTTCAACTGGAGGAGTGGCCCCAGAAGGAACGCCTGACAAAATGCTCTGCTCAAACAAGAGGTAATTCTTAG
ATCAAAACCTATATCCAACACCCATAGTTTGGAGTACGTACGTATTGGAGCACTCTTGCGAGAGGGTGAAGACGTGCTTTCACGGTGTCATTTTCACTCG
GGGACGGTGAGATGGCAGACCAATTCTGGAAAAGTTGCTCGCCCAACTCCGCTGTGTCATGGCCGGCAAAGCGCATTCTCCAATACAGTTGAGTAGCATC
GCAGAGTGTAGGCACCGCATGAGGAGCGCCGTCCGGTTGGTACGGGATAATGTTGACTTCCAGCATCTTGTCGATGCGATCGTAGTGACCAAGATCCAGC
ATGTACAGCGCCCACTGGAAGTACAAATGGCGCTCCAGCGGACCGCCATTGTCAAAACCCGCCTTAAACTGGTTCGCGTAGCTTGCTCCATGGTTGGCAT
TACCGCGCGCTTCCAGGACGTGCAGCATAGTGTGCACTATAAAAAGTAAAGGTAAAGAAAGTATCAGCACAATTCTAGTGAACTTAGGCTAACACCACAG
CACCTTACATGCCCAACGATCATTGCCGTTCATTGACAGCGTCTTCTCCGCCAGAGCTTCCGCAGCATCCAGTCGTCCCGCAGCTTGCATTCCGTACGCT
TGCATGCCCAGCAAGTGGCTGTACCCAGTGTCGTTCGGAGACCACGACGGCAGACGGCGCGTCACCGTAGCCAGCATGTTCTTGTGGTCTCTGCAGCATG
CGACCCCAACAAAATCCAAGTCAACAAAAACCACCTCCACTATCCCCCACGACCAACCCTCCAAGCTCTCACCCTAGAAACCGGTAGATATCATAGCAGC
AACGCAGCGCCAGAAGGTCCGAATGGTCCTGCTGCAGGATGGTCTCGTACACCCACGCAGCTTCGTGGTGACGGCCGTGCACCATCGCGTCCAGCGCCAG
CACGTGCATCTTCTCGCTTGTCGTGGTCTCTCCTGCATCACAGCACAATTACGCAGCTCACTATGAGCCTCTTGTCCGTATTTCTAACGCTCCATGAGGC
CTAGCCTAGCCTACAACCCACCTTCCTGGGCCAGTTTCGTAGCCACTTGCAGTCTGGAAGCCGCGTCCAGAGCGTCCTGATGCATCAGCGGGGCGAGGCA
CTGGCTGGCGCCCACCAGCACGTGGCCCATTAGAAACGGCGCGTCGTCCGCGATCACCTGCTGCAGCATAAACTTGGGGTGCGAGTTCATGCTCACGTAC
TGCCGCACGCGCACGAGATCAATTAGAAACTTTAGAAACGGCGTCATTTGCAGGAGGCACTCACGTCCAGCAGCGCCAGGTCGTACGCCTGCTGCTTGCT
CGTGCTGCGGCTCAGCGCCGTGTTGCGCGCGCCCTCGAACTCGCCGATGCCGAAGATCGAGCCCAGCAGCGACATGGCGCGCGTCGAGCGCCCGCGCAGC
AGCGGAGCTCCTCCACGCCTCAACATTGTGCGGACGTCAAATGAATCGCTTTAGAAATGAAACATTCAGAATTATACCGGTAGTTGTTCTAAATTAGAAA
CCCTAATATCTATCTGGTACGCTGTACCATTGTACCAGATTTTTGATGATGATTTTTGATGAAAGTTGCCTTTGATGCTCTCACCTCTGACATCTTCCAT
CTTACTGCTTTGAGTTTTTCTCTACGCTCGCGCGAGACTCAAGAATTCCAGGAGGTGCACCTCAAGTCGAATGACGAACGGATGAACGCGGGGGGACTTT
GGAGCGAGCAATGGATGAAAGCAGGTTTTGGAATGAAACCTCACATTTCCACTTTTATTATGACTGTCATTTTAGTCTTTGAAAACACGTTACAGTACGT
ACACATACCACAACTAACTACCACGGCGCTTTCTTTCGCGTCGCTCACTAACACTCACCAAAAACTTTCGGTCGCTGCACGTAGGGGCTTCTTCACATGA
TGTGCATGTTTGACCAGTTCTGCATATTCGAGTCGCCGCTCTGAGCTTGGCTGGTGGCCGCGACCTGCGAGCCGGCGCTAGCATTTGCCTCGGAAGCAGA
CATGTTCTCCAACAAATCATCCCACGGCGCCGCCTGGGCCGTGCTGCTGCCGTGATAAGCATCTCCGGCTCGTGGATAGGCTGACGGGGTAAATCCACCC
CTCTGCTCGTCGTGGGAGGTGAGACCTGGCAGCATTTGCTGTTGTTGTTGTTGCTGCTGCTGCTGCTGCTGATGTTGCAACACGTTGGCGAATCCCATGC
TCTTGTCCGACCTGACGTCCGAGAACGGCGACAGGCTCGAAGGACGCACGAACGGCTCGGGCTGATATTGTTGCTGCTGCTGCTGGCTGTAATCGAATCC
GGGACCTGATGACGCTGGCGGCGAGAGGCGTCCGTATTGTGGGTACTGAGATTGGTCCATCGGGTGCAATCCAAAGCGACTGACCTCCACGTTCGCCTCG
GGCGTGCGCATCTTCTTGACAGGACGCAATGCCTGCTCCGGTTGGACCTGCTGCAGTAAAGCTGGAATAGACGGTCCATTGTCGTGCTGGTTTTGCCCCA
ACACGGAGGACGAGTACACCGCAGCGCCAGCGCTCCAGGACGAGACCGCAGTGCTGGGCGGCATCGGAGTCACGCTGGCCGTGTTGGCCGGCGACGGGTG
GTGGTTCCACGCCAGCAGCTCGTCGAACTGTCCGTTGCGCAGTAGCTGCATCGCGCGCTTGCGCTTCTTGGCGTCTGAGACGTCGAGCCCCATCACGGGC
TGCCCAATGAGCACCGCGAACTTCAGAAAGTTGCTCACCCAGAACTGCTGCACTGCTAGGCGCAGGTTCTGCGTTTCGACGAGCGCGCCTTCGTCCGTGT
TGTTCTCGCGTCGGAACTGGTCCACGAGCTCCTGTCGGAAGACCTGCTCCAGCTGCGACAGCTCGCGCTGCCTGCGCGCGTGGTCCATCTGATCGAACTG
CAGTGCCTTCTCCCCCTTGCCGGGCTTGGTCACGCGGAATGTCCGCTTGCCGAGCGCGTTTTTCTGGAACTTCTTGGAGAGCCTCATGGTCGAGCAGTTG
AGCATCTTAGCGAGCACCAGGCGGATCGGCGTGCCGTGAGCCAGGGGCAGGGCCTGGCGGTCGAACTCGCACAGGATCCCGTCGATAAATTTCTCCTCGG
GCCGCGTCCATTTGCCGCTGCGGGGCTCGGGTCGGACCATCATGTTGACACTCGGCAAGATGGCTACCTGGTCCATGGGCGCCGCGCAGGCCGGGCAGGC
GTCCAGCGGCCACACGTGAACGCAGCGCGAGTGGAAGGTGTGATTACAGTTAGGGGCTACGAGGACAGGGTCGGGATACTGACAGACATCGCACATGCGC
TCCATGGGCATGACGGGCTCGGAACGAGTCTCGTGGGCGGCCTGAATGCGGTAGTCTGAGTGCTGCTGTTGCTGCTGGTAGGCCGCGATGGGCTTGTGCT
CGGGCGGGGACTCGGCGTACGGGAACTGGGAGATGGCGACTGGCGTGCGGCTCGGCTGGTAGTACGTCTGCTGCGGCGTGAACTGCTGCGGCAGCGGCGA
CGGGTGGTAGTAGGCGGGGGCTTCGAGCGTCGGCCGCATGCTCGGGATGGCGGGGCGCTCGGGCTGCTGCTGCTGCTGCTGGCTGTACTGGGCGCTGTAT
TCGTAGTCGTAGTGCTGCTGCTGGGGCCCACCACTTGGCTGCATTCTCGAATTCTTGAAGGTTGGCTCAAAGACTGGTGCTCGCGCTTCACAAATCATAT
AAAACCCTGGGGGCGTTCGTAGCTTGACGAGGTTCTTGTTGCAGCCTAGCAGTTGGGGGGGATACGCCGCGTTGGATACGCCGCGTTGGCCGAGACGGTC
GTCCACCGAGTTATTGAGTTGGGTTGCTGGTCGCGGCGCGCGCTGAGTGAGCAGTAATGGATGAATTCGCGACTGAGACTCAAGTGGGCAAGGGGGGGAG
CTCACTCGTGCAGCGGTGGCTGCTGCTGGCTCAAATTCGGCAGTATCAGGCGATACTGTAGTGTAATGTAGACACACCAGAACACCCCAAGCACGAAAAG
GTCCAGGATTAACTCCTCGTTTTTGTGGTCTTGCCTTCCTTTCCCCTTCTGGCGTTGGCGCTCGGCAGTGGAGTTTCTCGGGCTCGCGGGGTTAAGGAGA
AGCCGCACAATCGTGACGCGATTTGCTGATGCCGCCAATTGTATTGTACGACGACGCTCGCGAAACGCGAATGGGGTCCCCGCTCGCTGCTGTTGCTGCT
GCCGCTGCCGCGAGACCCGGCGCTGGCCCGTCCCACTCGAACGCGGCTGTTGCAAAGTGGCTGTCCTGGAGGAAAGCGGGTGTGTGGCTGGGTCACGTCG
TATTGAGTCAAGCAAAGCTCGCTGCTATAGTGGTGGGACCCCGCCGCGCTTGGCTGGGCCTGCAATGCTGGACGAGCCGGAGCCGCTGCACCTGCCGCCC
GGTGCCGGTCGCTGGCATCGGAAGCAGTGCATTGGGGCCTGCTGGCCGGCTGACTGCAACCTGCTGGGTAGCAGACGGTCGGACGAACGCCCCCGATCCT
CCATCGTGGGACGGAAAGGACCGGCGGCGCTGGGAGCAAGCGCAGGATAGGACCGCGGCGCCGGCCACCTGCTGGCAGGCAC