Description :
From Genome Similarity Track
Location :
Scaffold_322:6488- 11286
Sequence
4798 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGAGCAAGCTTACTTGCTCCGAAATCCAAAATTGCATGTCTAGGTAGGTTCTATGTTGCTAACAGAACTAATGAACCCTTTTTGAATTCATTTGTGTTCT
TTCTGCCGCCATTGTCTGCATTCAGCTTCAGTCTATCCAAAGAAGCTGCTATCTCGTTCTGGACAAACCGTATGACGGCTTGTCGGCGCTGGACAAAGTC
CTGTGCTTGCGTGTTGAATGGTTTATTCAACATGACTTCCTCCGCTGCAGGTCTGACCTGCGCGCTGTCTGTGCCCCGCACAGACGTGTCGTTGTCTTTC
GTGGTGACTGTGCTCGGCACAGCCAGATTGTTGTCGATCTTGTTCACCTCTCGTTACCGGAACGAGACGTTTGTTTACGCGTCGACACCGCTGATACCAA
GTCGACACCGCTGATACCAAGTCGGTATCAGTGTTCTTCTGTGGTTGATTCGACGCAAGCGTAGATCCTCCCTCACTTAAGGAGGGAGCCACCGTTCCGA
GCAAGCCCGGGAGGCGTGGATGCCGCATCGCATTCACGTGACGCGGTGTATGCCCTGTCGAGGCATGCACCGAGTTGTTGATGGCAAACTCTGCCATCGG
CAAACAGTCGCTCCACTGTGGGAACGAGTGTGCGTAGCACTTCAGCATGTCGCCAAGCGCGCGACTCACACGCTCGGTCTGACCGTCTGCCTGTGGATGA
TCCTCAGTGGACATCGCCAATTGTGTTCCAAGAAGTGTAAACACTTCTTGCCAGAACCGCGCTGTAAAGCGTGGATCACGGTCCGACACAATGTCGACCG
GCATGCCATGGTGTTTGAACACCATGTCAAAAAACAGGCGTGCAGTCTGCACGGCTGTGACCTCGGCTGGTACTGCAGCAAGATGAACCATCTTGCTGAA
TCGGTCTACAAAGACCACAACGCCAGTCCTCCGCTTGTTGTCGGGCGGAAGGCCGAAAACAGAGTCCATAGAAATGGACTGCCAACACTCCGACGGTGTC
GGTAGTGATTGTAATGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGCGCCCCGCGCCTACTGGTTCCGCGCGTTTTTTTATTGTACGCGGCGATGCCCGGCATCGCCACGTCGGCCCCCGG
CCAAGTGCACAGTCGCTGTGCACTCACGCGCAAAGTGTCCGGTGTTGCCACATCGGTAACACCGTATCGGACCCCCAGTCCGCTGTTGGCGACAGACAGC
CGAAGCATTCGAAAGGTCCATAGGCTCCGGACCTTCCGTTCTTACTATCGGACGTGCCATCCTTGGCACGTTCGCATGTAGCTTAGCCTGCTTCAGGCTA
AACTCCTCTTGCATTATAAGAGTGATCGCAGCTTCGAGAGTACCAGGGTATTATCTGAAGAGATAGGTCTTAACAGGCCCATCCTTCAAGCCCTTCATTA
ACGTGACGACCTTAGTCGCCTCGTCGATCGGGTTGGTCACAATGTTTGAGACCAAGTACCGCGTACGTTGGGCGTAAGCATGAAAGTCATGCTTACCGTG
CTGCAGGTCGAGAAACTCCGCTCTCGACCGGAACTCATTCTGCGGGGATTCAAACGCTTGTCTGAGCTCTTCCTTAAGCACCACCAACGTGCTAAAGC