Description :
From Genome Similarity Track
Location :
Scaffold_34:6488- 7519
Transcript NameFunction/comments
Phymu_g2031hypothetical protein PHYSODRAFT_359407
Phymu_g2032Mitochondrial Protein Translocase (MPT) Family
Phymu_g2033conserved hypothetical protein

Sequence
1031 bases(100 bases per row)
TCGTGTACAGAAGCcgcagaagctcttcaacagcaaaggATCAGGATcaggaggagatggaggaggagccgAAGCACACATAAGACAACCAGACGTAGAA
TAGACTTGACTTTAgactgcttctgctgttcatTTCGTCTTATCACTGCGAAGTTCTCTAGCTTTAGGCGCTGCCGCTCTTGTTGACGCGGTGCACCACA
AACATGCTCGTGTCCAGGTAGGCGAGCGTCACGTTCTTGATGCagtccttctccttggacgagagctccgaGTCGGGCTTGCTCGCGCTGCACCTGTCCC
AGGCCATCGCCGTGATCTTAGCCACCGCCTGCTGAATGagcgcgcgctgctgctcctccatgatcagctgctgcatctccgcGGCGCCAGTGGACGCGCC
ACCAAGAGACGATGACGGagcggaggaagaagaagagtcgaaggacgacgaaggcgtcggcGCGCTGTAGTCGTACGTGGGCTCCTCGTACGAGTACGAC
TCCGAGGAGCTCGTCGGCTCCGgctgcttgctcttgccaAACCCGAAGAAGGACATGCTCGCTGCTACTGTAGTGATCGCTTGGCTTTGGTCTGTGGTTC
TTGGTCTCCGCTCTTGTGTCGGTACATTATGTTTAAGAGCAGCTACAATTTTTAAGCATCGTCCAGTTCGTACTTATCCGAAAATAAGTACTCTCTTAAA
CAGTTATGTGTATACCTCGTATAAAATCATTGTATACAGTTTAAAAGTCACCCGTATAAATATATACTGGCATAAATTGTTGCAGTAGGTAGCCATCAAG
GTTACAGAGGTATCTGCTACGCTTCCCTCCCCAAGAAGGCGCCAAACGGACCATGAGCTGGTTGCGCTCCAAGCTGCGGCTGGTGGCGGCGCGAGCGTCG
GACGCCCTCGCCCAAGCTGCAGACCTGGTGGCGCCCACGCTGTACGAGTCGCGCGTGGACGAGTTCCACCACCGGTGGACGACTGTGGCGCGTTTCCTGG
AGTCCGTTCTGTCGCGGGACCTGGAGCCGGC