Description :
From Genome Similarity Track
Location :
Scaffold_430:6487- 11875
Sequence
5388 bases(100 bases per row)
TTACACCTGGTAGCACTTAGTAGTCCGTTCAACGACAATGAACATGTTCGACGATGAGGGGGATGATTTTCATCCCACGCATGGAAGCTACTCCCATTTG
AGTCAAATCGAATGGGATGCCGTCGAACGCTTGAGTTCAACGATAGGGTAAGAAGCTGTTGGCGCATTGCTGTCCGCCCTGGGGCCAGACGGGCAACACG
CCACCATCGCCAAGTTCATTCAGAATGAACTTGACGTCGAGTGGGGAAAGGTAACCTTGCGTCACCAACAAGGGTCTCAACAGACAGAGCTGTTGAGAGA
ACAGAATGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGACCACTGCTACCGGGTCGACGTATACACGTCGACCCAAGACTAAAGATTGACATTTCAAA
GTACAAGGGAGCCGATGAAGACTCTCTGTTGAGATGGTTTGTGGACTAGACGATGCCATAAAGGCTCGCCACATCGTCGATGATCAAATGCAGATAGCAT
TTTCTCAATCGAACTTGGCAGGACGTGCAAAGACGTGAGTCTTGGGCCTCAAGCTATACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCAAGTCCCT
GCTTAGGCAAACTTTTGATCTGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGAAAGGTAAACGTGACGTACACTCGTAAATTTAG
TACATACGTCACCTTACCAGTTGCATAACAGTTGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTTTTAAAA
CCTACCTGTTCCGGTTGGAGTTCAACACCCTGGAAGAGGCGATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTCGAATTC
CTATCGTCCGTCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTCACGCGGGGATCGAGAGCTCTCGTGTTAACAACTAAAAGAAATTG
CAAAATTCAATAGATATCAGAAGACAGGGCATTATGCATACGAATGCAGTACCCCGAACGCGGGACCACGTACCGCAGGAAACAGTAACCGCTAAGCGGC
CAAGCGAGGTCCAAGGCGTGGTTCCGACGTTGTTGCGAAGACGCAACAACGTAACGGATAGCCTAAAAATGGTCGGGGTTAGTAGGTGCGGAGCACCCTA
CTGATCCAGCAACGTCAAGTGAGTTTGCAGGACTCTTGACGAGAATTGCTTCCAACACTCAGTCATTGAGTGTTGCTGCTTCTGGTAATGAGGGTTACCT
CATTACCATGAAACACGAAGTGATACAAAACATGTCGCTTCGAGCCCTAGTCGATTGATTGTGGGGGGGGGGGTCGAACAACTCTGTATGACGCCAATAC
AACAGAGAGCTCTAATATATATAGCGCTAGATCCCTCCAAAGAGGATGACGGTGCGCCTCACGACAGGCGCATCCGTAATAGTGATGAAATGTGTAGTAG
GAATTTCTCATACACTGAAAGAAGTCCAATACGATGATGACTTCATCGTCTTGGACTTGGATGACAAATTCGATGTTATCCTTGGTTTACCGTGGCTTAG
AAGATACGAACCACAAGTCAGATGGCATCGACGAAGTGTCAATATTCCTGCCGATTGTTCATCAGACGTCCATCCGATGAACGCCATGGAGCGCGGCGCC
TACTAACATGTGGGTGTACTACGAGCGAGTGTGATGGCCTCGCGTGTGGTTCGGTCGTTAGCACGACTGCAGATGGGCATGGCATGGCTGATTGCCACAC
CATGGAGCCAGATTCGGGCGACTGCTTTGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGCGGACTGGGGCATGGGTGTCCTCCAAAC
GGTCAACACCCAAGTGACAATGAACCGATTGCCAATTATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGACCGCGGTAG
CTCAACCACCGCCAGAAGATAGCGAGGGAGCAATTTCACTCGTGTCATGTGATGATTTAGCCCAAGAGGCTACTGCGGGAATAAGTCCACACCCAACTGT
GGAAATAAGTTCCCAGGTAATAACAGAGACATCAAATTGTCCTGGTCAATGACGGATCAAGAATAGGCACTTACCAACTTGATCTGATCGCGCCTCCGAA
GACAACTTCGGAGATCACTCAGTTACCCCCGCTCGAACAGAAGAGGTTTTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCG
GAAGATGAGTACGTAACCGATATTCGATCGGCAAAGGTATTCGATGAGAACAAAAGGGTTCTCAGCAGCTCATCAACGGACGAGAGCATCCTTGATGAGA
AGACTCGGATTGAGCGATATACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGACGGATTTCAGAGATGTGTTCCCAGAAAC
AGTACCGTGCGAGATACCCAAGGATAAGGGTACTCGTCATTAGATCGACCTGAAACCAGGTTCAAAGTACTGTGTCATGAAGCAATGACCACTGCCTCGT
GAACAAGTACTAGCGATTGACAAATTCTATGCCAATCACTTGGCAGCGGGCCATGTGAGGGAATCTAACTTCCCACATAGCTCTCCGAACTTCTGTTTCC
GAAAGGCCACAGGGGGATGGAGGATAGTATATGCTTTCAACAAGTTGAATGCTGCAACTGTACCGGCCCAAAAGCCGATACCAAGGAAGGATGTCATTAT
AGATGATATGGCCAGGAGTATTATCTTTTCATAGATGGACCTGATGGACGGGTTCTATCAGATCCTTATGCACATAAAGGACATCCAATATACTGCAGTG
ATCATCCCAAACGATATTCTTGAGGAGTGGTTAGTATGCCACAAGAGCTGAGTAATGCCCCTGCTACGTTCAACAGATGCGTTACGAATCTGTTGAGATC
TGTGCGAGAATTCGCACCTAGCTATTTTGATGACGTGTTCGTACATAGACGGGCTATGGATGGACAGACGGATGTGGAAGTCCACCGACACCACGTCCGA
AAGGTTCTTACACTGATGCGTGAGCATCAGTTGTATACCAACCTCAAGAAGTGCATATTTGCTGCTAGCGAAATACCACTTCTTGGTTGCATCGTGGACA
AGCATGACGTCCGGCCCGATCCGGAAAAGATAAAGGCGATCACTGACTGGCCGGTGCCTACCGATATAAAAGGACTTCGATAGTTCCTTGGCCTAGCGGC
TTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGCCA
GCGCTCCTTCAAAGGTATCAAGCAAGGCTTGATACGCTCGCCAGGTTTGACAATTGCAGACCCAGACAGACAATTTTAGGTGGTCTGCGATGCAAGTGAT
TTTTCTATCGGATATGCACTAATGCAGTACGACACAGACGGTGCTGAGCGTGTCGTCTGTTACCAGTCATGCCAGCTGCAATCGGCTGAACGTAACTACC
CAGTCCATGACAAGGAACTTCTTGTCATGAAGTACGCTTTGGAGAAATTCAGAGTCTACCTGCTAGGTGATAGACCCTTCATCGTTTACACGGACCATGC
GTCCTTACGCACGGCCGTTAACAGTTCACACCCCTCGCAGCGAATGGCGAGGTGGCTGTCGTTCTTGCGGAATATAACTTCTCCGTGGAATATAAGCCAG
GACGACTGAATGTTGTCGCTGATGCTCTGTCGCGCCGGTCCGATTTCGAACCGGCTGAGCAAACCGACACTGATCCGACCACTGCCGCGGTGTTGACGTC
GAGTGTCCCGTCGTCAACCTTATTCGAAGACGTACGCAAGGCGTACGATCCGGCGATGGTGCGTTTGATGGATCATCTTTCGCAACCATCCCGTCAATCC
CTTAAAAGGTTGCCCCCAGTATATCGATCCTCCACTGATAGATATACATCCTACAATGGCTTACTGAAGTATACAGCCGTTGCCAGCGACACGCCTCGTG
TCGTCGTACCGGACCATGGTGACATGCGACTGCGCATCATATTTGAATACCACGATACACCTACTGGTGAACATCGTGGTCGAGAGAAGACGTATCTCAT
AGTTAGTCGTGACTTTTACTGGCCCCGTCAGTATCAGTTCGTGCGTAAGTACGTCCGCGCATGCGAAGTATGTCAACGAATGAAGTCTGGTCCTTCACTT
CGTGCGCCGTTGCAACCCTTGCCCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGGCTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACAG
GTATTCTTGTGTTCGTTGATAGATTCAGTAAAATGGTACATCTGGTCGCTGTACCTGATTCTATCAGTACATCGGCATGTGCTCGTGTTTTTATTGACAC
GATCTTTCGTCTTCATGGGTTGCCTCGTGAACTCGTTTCCGATCGAGACCCACGGTCCACTGCCAAATTCTGGCGATCCGTGCTCAAAAACACTCGGAAC
TCGCCTTCAGATGTCGACATCTGACCACCCTGAAACAGATGGTCTGACAGAATGCGCCAACCGCGTTCTTGAGGAAATCCTTTGGGGTTATGTCCATTCG
TTTACAAATTGGAGCGAATTCTTGCCAATGGTGGAATTCGCCATCAACACCTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCTTGC
ACCACCCACGCGTACCCACCTTTTTAGAGTGTGACTCTAGTTTGAGGGGGGGAGGAAATCATTCGAGTGAACGCCAACTCGGCTCTCACTCATCACGTAC
TGACCACGAGGTCACTCCATATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGGGGAAAGTAAGAACGAGGGTTCTATTACTACCCAGGTCACT
GATCTTGCCGGAGTGCGCTCCAAGCGCACTATAGCCAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGCTTGTCCGTTTCGTGCAAG
ATTCCATTACAGAAGCGGTGGACCGACAAAAGAAAATGCTGACAAGAATGGAAGGTAAAATGTTCTTTCATTCAATTAAGGTGACCTGATCCTACTATCT
ACGGTAAACCTACCTCGACACATAGTGACTAACGTGGGTAGTAACAAGCTACTACCCAAGTCTATCAGTCCATTTCGTGTGCTGCGCCGCTTAGGTAACT
CATACACGATTGAACTTTCACGTAAGATGCGCACGCATCCTACGTCTACGTCGGTCGCCTTAGGCCGTATCACCAGTACGAGACTTCT