Description :
From Genome Similarity Track
Location :
Scaffold_35:64864- 65872
Sequence
1008 bases(100 bases per row)
TCGACTTCATACTGGTTCGCACTTGCGTCGGGCTTCCAGCTATCTTCCGGTAGCAATTCCTCGTCAAAGTCAAATCGATGAGTCTCTTCGAGCTTGGTGA
TTAGACTTGCCTTGCGTTTCTCGCCGAGTTCGGTGGCCGCTTTTAGACGCGATACATAGACCACTGGGTAGAACCTATATCCGGTCTTGTCGGACAGCTC
CAGCTCATAAGCAACTTCTTCCACCTTCTTCTTCACCCAAAATGGTCCATGCTATCGATGCGCTAACCTCTTTGTCAGACCCGACTTGACTCGCTCCATA
AACAACCAGACTTGGTCTCCTTCTTCGAACAAGGATTCAGTGGATTCGTCGCCTGGTTCTACAACTCCGGCTTCGTCGTTCGCTGCGTTGAGAATGGAAC
CTTTCTCTTTCTTGCTCAGTGTTTCATTGTGTTCTCGAGGTCACCTAGCTTTTTATCGCACTTGGAACTCGGCTGCTAGACGTAGGGCAACTTCACGTTG
TCTGTACCCTTTTCGGCGCCACTCGACAACATTCGCCGAGTTAGCCGAGCTTCCCTGTCTCTGTCTTATTGAGCTCGTCATAGCCTTGAGCGTATACTTG
GCATCCCAACCGTGCACTAAATAGAAAGGAGTCTCTCGCCGAGTCGAGTCTCTTGAATTGCTGATAGAGTGTACAATCTTCTCGGCGATGTCATCCCAGT
CGGTCTGAAGAGGGTCTTATACGTAGACTCGTATAGTCGGAGCCATTGTCTTCACTGACCTCTCTCGTTGACCGTTGGCTTGTGGTCGGTAGTTCAGCGT
TGCCTTTGATCTCGACTGCATCATCTCAGAGAACCTTTGGAACACTTCGCTTATGAACCTTGGATCGCGGTCGTGTCCTATTAGTGACGGAGCTCCGAGC
TGCCTGAAGACGCATTCTTTAAACACCTAGACCACTTCGAGTGCCCCGGTGTCGCTCATAGGTTAGCAATAACGAACCCGGTGAAGTGATCCTCAGATCA
ACGTGCAC