Description :
From Genome Similarity Track
Location :
Scaffold_12:64861- 73901
Transcript NameFunction/comments
Phymu_g898hypothetical protein PHYSODRAFT_508492
Phymu_g899hypothetical protein
Phymu_g900hypothetical protein
Phymu_g901hypothetical protein PHYSODRAFT_560612
Phymu_g902hypothetical protein PHYSODRAFT_560612

Sequence
9040 bases(100 bases per row)
TAGCATATCGTGGAGACGCAGAGACACAAGAACGCAGTCACGTAGCGGCGCTTGCCTTGCGGCAGCTTCGCAGAGGCGTCTCCCGAGCCTGCTGAGACCA
CGTCAGCCTTCTTCCACGCCTCCTTGCTAGCCATGCTGCAGATGTCAAATGGCTTGGGGATAGATCGGAGTCGTTACACTCATCAGtgatttcagccaat
cacaggaGGATgacccacttcaacgtgcaGCACTTCACTCAACTAGCTCGTGGATTCCATGGACAACCAATAATTTGACAACCTCGCACCGAGCGCATAA
GCTTTACAAGAGAACTAACGGAAGTTGGAGGTGTCTCCTAGCGGCGACTTGGCACGGTACCGCTTCGGCGCGGCGAGAGCGGACGTTTTGGTGGACTTGT
GAACTGCAGCCCCTGATCTGGGGACCTTCATGCTCCTATGCGGGTGGGCGACCACAGGCTTCTTCTTATGCAGACCAGATGATGTTGTCTTTCTGAGTTT
CGTTGGAGTACCGTTGATCGCGTTCGTAGCAGCCTTGGTCTCAGGCCGATGACCCGGGCCCTTTGCAGTTGCACTTGAGTCGCTTGACTCGGATGCTAAT
ACCGGGGCTGGATCGATTGTATCCTGGCTGCTACCTGATGAACTTTtagcagcagattcagcgGCCTTGAAGGCATCGATGCTCATAGTGGCGTCACTCT
GGGACTGTCCCGTGGTTCCTTCAACGGGCGTGACGTCATCAATGGCGCTTGGACTAGCACTGGTGTCATTCAACCGCCTTCTCTTATGACCAGCGAGAAA
CTCGCTGCTTATCGCGTGTGCCTGGCTGGATGAATTTCTTGAAACGACTGCACCATTAATAGGAACCTTGGTGGCTTCGAATGAAGGGAACGGACGATGA
TCCTTTTTCATCGGTGTGTCACCTGTCCGTGCAGTAATCTACAAGCAATAGCCAACGTTTGGTTAGTAGAAAATTCAAAACGAGGAAGTAGTGTAAACTG
caccttgcgcttcttcatgtagGTTTCTGTAGCTTGCAGTTGCTGCGCCGATGCTTCGCTAGCTTCTCCAACAATTTCCTTGCCAAGATTTGACATTGAC
ACAACCTTTGCCGTCGCCTTAGACATTTGAGTTTGAAGCCCTTCATTCAGCGTCTTGCACCCGCCAATCAAGAGTTGTCGGAGCTCTTCATGATCACCCA
AAAACTGCGTTAATTGTCCTTGCCTCGTGTTCGACATCTCCACATCAGTCTTCGAGTGTTTCTCCAATAGAGACGACACATTTTCTGTGTGCTTTGAAGG
AAGCAAAGCAGCATCGTTACTCCACGAAGTTTGTAACTGGTGGTGCGACTGAACCAGCTCTGATTGACGCGATGAGGCCTCACCGAACAGGCTTCGTAAT
TCGGACAAACGCTCGCGCAGACCAGCGGTCTCAGTTTCATGCTGGGAATTATGGCTGCTCACTGCCTGCACGAAACCCTTCACTTCTTGTTCCGTGATAG
TCTGCACGTATGAAAGCTGCTTGTGTTGCTTCTTGGAGTTTTCTTCAATCATCAGAGTCTGCTCATCTATCTTCTTGGATTGGCTTTCAATACAATTCTC
GATGTACTGAGTCAGTTGGGCCTTCATACCATtgagttcttcttgttgctggataTGGCTGTCCTTTAGCGCAGTCATGAGTGCGCTTTTGTCTTCGTCA
AGCTCCTTAGCTTGCCTCTCAATTGACATGTCAATTGCAACCTGCAACTCGAGCAACTTATCATTGTGCTCATTGAGGAAGCGGCTCAACTCCTCCCGAG
ATCCCTCCAGCATCGATTGCACGCTTTCCAGGAACGACGCATGCCGCAACTTAGACGAAGCCAGATCTTCCGTAAGCACCTTCACGTGGCTCTTTGACAT
TTCAACACATTTCccgatctgctgcagcataGTTTCCTGATGGTTCGTCATCGCTGTTATAACTTCTTCACGTTGTGTGCACTTTTGAGTGGCGTCTTCA
GAAATTGCCTTGACAGCCTCATCTTTGTGCGCTTCGACAAGACCTTGCAGAGCATTTAGACTCGTGATCAAACCATGCAAATCAGTTGAGTGTGACGTTT
CCAGTTCGCGCATTGCGCTTGACACGTCCTGAAGCATGCCTTCCTGACTCTCCTTGTGTTTAGCCAGTCGCTCTAGGAATGCGTTGATATGAGACTGCGA
GTCACTATGATACGAAGTCGCCAGCGCTATGTTTGTTTCTTCAGCTCGCTGGGTATTCTCTACACACAAGAAAGATGAAGCGTAAGCTCAAGCTTTTAGA
AAATGAAATCATTGCATCTTGCGTACCGATCTTCGACAATAGCTGTGCTGCCCGCTTTTCACTGTCATCATGCAGCTTCGCAGCAGTTGCTCCGTCTACC
AATAGCTTCTCTTCATTCTCCTGATAGGCATTAAGAACTCCTTGTACTTGTTGGAGTTCCCTCGTAACAGTTTCCAGTGTTTCCTTCGTGGACATAAGTT
CGCCTTCCGTAGCTGCTAATTTGCTGATCacttcctgcttctcgaggGTTAGAGCTGCTACCTCGTTCGCATGTTTTTCAGCGACTTCCTCGAGCTCTTT
ACAAGAAGAGTCTCTTGCCTTCAGcgtttcttccagctccgttAGTTGTGCACCTTGTCCAGCCAATCGTTCTTGCATGTCAgtgaactgctccagcggG
AGATATACGCCATCTTTCAGTCTCGCAGATCTCAAGGCTGCGCGAAGTGTCTCAATTTCGCTTCCGAAATCGTTCAAAAGTCCTGCTTTAGTCATTTTCT
GGTTCAGCTCAGgcttgttcttgatgttTTTAGCGCGGAATGCATATTCAAGCGTGCTGAGCGTCTCGTCAAGGCTGTCAGCACAGGGAGCTAGAGTTGC
AATGATGGTGGTCTTGGCTCGGCCTCCAAGTGACTCCTGCAGCAAGCGCGTAAGCTTGCTATCTCGATACGGAACGTGCGGAAGATTATCAACAAGCGCC
GTAATAACACGTCCCAAGGTCAGCAAGCTCTGGTTAATTGTGCCTGCCTCTCGTGCTCTGGCATTGCGTGCTCCTGAGCGACCTACGCACTCTGAGCCTG
CAAGATCCACGAGGTTCAACTGACCGACACGCAGCAAATCTTCACCCGCGGCATTGTGCTCCTTGCTGTGGATTCGAATCGTAAAAATGCTGTGTGAACG
ACTGGAGTTCTCGTTCATCAGTGTCTCAGACGTGATACGGTTTTTGACGCCAGTATTCACAAGCTCGTACACATGCTTCGCTGTAGTTGCCGTGACTTCC
AATAAGTTCATGCAGTAGATGCCTCCTCTCTTTGTATCCTCCATAAGTCTCAGCTTCTTGTCTGTATCCGGATCCAATAAATCCTTGAGTTCTTCATTGT
AGAGTTGCAGGAAGGACACACGGACACTAAACTCTTCTCCACTGGTCTCCAGGGCATCAAAAATGTAGCGTACGCTGCGTGGAATGATGCCAGCTGTCTC
ACTGCCCGGCGATAGGTCGCCCTGCATTGTGTACGTCTTGCCTGTGCCCGTCTGGCCGTAGGCGAACACTGTGCAGTTATATCCAGCCAAAGCTTCATCC
ACTGCAGGGCGAACAACCGACGTAAATACATCCTTCTGCGTCGAGTACTGCCCGAATACGCGGTCGAACGTGTACGTCTTGCGCTTCACAACAGCCAATT
CGTTCGCGTTGGGCTTGCACTGCACGACGGCTCCACGGCACGCAGACTTCTCACGGCTGTTAAGGGGGCGACAGCGCACCGCCACCTGCACATTCGTGGG
CGTGGGCGGACCTTCGGGCTcagaggacgacgacatgcgGCGCTGGTCGCTGAGCTCCGTCATAGGACGAGCTCCTTCCTCGGTTGAGATTTGAATTGTA
TTCAAACTGCGCGCGCGGaaaagagtgatggtcatcaATATATGGTGTTTGACACACCATTTATGAAGTTTGGTGTTCGGAAACACCATTTTACCTGCTG
ACCAACCATGCCGGCCGCTTTGAAGAGCATTCAACTCACTCCATCAAATCGGTCCGTCGAGTcgcaggaagcagcaggaattTGAGCGACATGGCGCAGC
CCAAGGTGAACGAGACGCTACTGGACGGACAGAAGCCCTTTACTGAGTGCGAGTTTGGTCTGGACCGCCGTCTCTCCAAGGCAGTGGCCAAGATGCGCTT
CGTGCACGCTACGCTGGTGCAGGTGCATTGCATTCCTTTGGCTATGCAGGGAAAAGACTTGCTGGTGCGTGCTCGTACTGGATCTGGCAAGACTGCGGCC
TTTGCGCTGCCTCTGTTGCACAAGATTCTGCAGCATAAGCAAGATGCTCCTGCTAGCGAGCCCGCCGTGCGtgcgttggtgctggtgccCACTaaagagc
tggtggagcagacGCGTCGCCACATGATGGATCTCATGTACTACTGCCAGGATTCAGTGAGTCTATTGGCTCTGGGAGGACAGAGCATGAACGCTCAGCA
GGCTTTGCTTCGAGACGCACCGGACGTGCTGGTATCCACGCCTGGTCGTCTTGTGGCACaccttggagctggaaatCTTTCACTCAAGGACTCGGTGCAG
ACTGTCGTCATTGATGAGGCTGACCTAGTGCTGTCTTTCGGATACGGTGAGGATATCCGTACTATTTTCAATGCGTTGCCCAAGGCATGCCAAACGTTCT
GCATGTCGGCCACGCTCAGTCCTGAATTGGAAAAGCTCAAGCGCTCTGTCCTACACAACCCCGCAGTCGTGAAGCTTGAGGAGGGAGCGACCGACGGAAA
ACTACAGCAGTTTTACCTTCCGGTGAAGCCTGCGGACAAGGACCTGCTGCTctacgcgctgctgcgtcttggcgtcgtgAGCGGAAAggtgatcttcttc
gtcaactcGACGGATGCTGCTTACAGACTCAAGCTTTTCTTCGAGCAATTCGTGATCAAGAGCGCGGTTCTGAATGCCAAACTGCCGCACAACTCGCGTC
AGCATATTATCGAGGAGTTTAACCGCGGTCTTTTCGACTATCTTATCGCAACGGACGATAGCATCGATCGCGATGAAGTTGGagacgaggatgaagacga
tgaggaagacgatgaggaagaggaggaaggtGACGACGAGAAATCCGACGCCGACGCTGAATCTGATGTTGAGAGTGATGATGAGAAGAACGATGAAGTA
GACAGTGAAAAAGAAGAGAGTGACagcgagaaggacgaggaggaggctaCGGACAGTGGCAATGAGGCTTCCGAAAATGAAGAGggtgatgaagagcagc
aggaaaaGAAGACGGTTGGCGCTAagcgtggacgagctgctgatGAAAGCTACGGTGTGTCTCGTGGTGTTGATTTCCGCGGCGTTCAGTTTGTTATTAA
CGTGGACTTTCCGAAAAGCGTACGTGCGTACACTCATCGTATCGGACGTACTGCGCGTGGTGGAGCATCTGGAACGGCTCTGTCGCTTGTGTCCAAGGAa
gacgccaaggaggagcgtGCGCTGAAGCGTGTGCAGGCGAAACAGCAAGCCATCCGTTCCGAAACGAAAGACATCATCGCTCAGCCTGCGGAGTTAGCCT
TCGATCTTAAGGAAATCGACTGTTTCCGCTACCGTGTGGAGGATGTTCGTCGTGCTGTCACGCGTGTGGCCGTCCGCGAGGCGCAACTGGCTGATGTAAA
GAAGGAGATGCTCAACTCGGAGCGTCTTGAGGCTCACTTCCAAGCGAACCCGCGTGATCTAAACATCCTTGAGCACGACAAGGTTGTGGGGTCTGCACCA
GTGCAGGCTCATTTGGCTACTATCCCGGACTACCTCGTGCCtattgagctgcagccaccagcaccagcacgcaccaagaagaaacacaaCAAGCGGCAGC
GAATTGCTGATGGCAAGCGTCGTACGGATAACGACCCGTTGCACACATTTGTGGCTCCTGACGCCGACGATGACAAGAAACAAACTGTGGAGGACCGTAT
TAGCTACGGTAACAGTGGCGTGGGAAAGAGTACTGCTGGTCGTCAGAAAtggaagaagcagcatcgCAAGGGCCACTTCAACCCCAAGACTattgccaag
aagaagttcaggATGAGCAAGGGCGCCACTCATTAAGAAGTTGGAACAATTTGCAAGGTTGGGGCACATGTTCTTGCTTGTTTTGCCAAATAGATTCACG
TTTTTGCTTGATTTTGTGGTGCTCTGGGTCTTGTACGACGGCTACTGAAGGTTCCGATCCACCGTAGAAGCGAACGCCGGCATTGAGACGGGTCGACTGG
TTCCGAAGTAACGTAGCGCTGCAGGCGGTGCGTTGCTGGGCGGAACAAACATTGCGATGCTCTCTGGGTCtccttcaagctgctgctggactaGTTGCCG
CCACAGTTCATCGCCTGCAAGTTGTGCCACTCGGTCTGCTGGCAGTTCTTCATCGGTCACATCCACCTCAACTAATGCCGAATCTGCACGAGGTTGCAAG
GCGTCGGTCATCATTCGCTTCCGGTCATACGCATAGTCCAAGAGTTGCAGGCTGCGCATGTGTTCAGCATGCTCGCGTTCCACACGTTCAAGACGTCTGT
GGTCTGCCTGagtgctggctgtggcaCGCGCTGCCAGGATCTCAGGAGGTGCAGGGAAGATGGTACTTGTTGAAGCCGACAGCGCGAATAGAGGCTTGTT
GCGACGCACCACTTCCTCACGAAGCGCCCGGAAGTCACGCGACAGGAGAAGCTCCTCTTGTGCAAGTGCCTTCATCGCACAAACCTCTCGAGCTCGTTGT
GCTCGAGCATCCTGCTCAATGGCCTGGCAGTGCGCTTTGTGAAGCTGGTTCCAGTGGCGGGTCTGGTCGGTACGAGCAATTTGCATGTCAAGGCCGTTCT
CGCGGTGATCACGCACTTCCTCGTTGTGTACGTGACGAGAGATCATAGCCACACTGGCAGTAAATGCGCGAGCCATGTCTGCACTTTGCTGTCTTGCCCG
TCTAGCCAATGCctcggcctccttcttctgtcgACGTTGCTGTGCTTGCGCGTTTTTTAACTTAGCTACCGCTGCCAGCGTTCCAGGGTCAGGCATGTTG
TGTGGACAAAACTTGGagtgaagaagcgctggagcagatgctgATGAGTGAAGTGACGACATTTGTGGAGGGTTGCAAGCGTACGACTCGTAGGAaaacg
tgctggtggcgtcGCTTTCATGTGCAATCTGATCAAATGGCGATAGATTCGCTTGAGACGGTGACTGATGTTCGCATTGCAGTGGTAACAGCTTCTTGTG
TTTTCCTTTTCCACTTTTCATTGCGCGTTGCTGTTTCTGCCACGTTGAAAGACTACGAACGTGCTCGATAAGGAACGACTCGGTAAACCATAGACGACAA
CCTTGAATGAAATCGCTGACCGAGACTGTCGGTCCTGTCATTGTCGTTTGCTCATGCGAAATACGGGGCGGTAGACGTTGTTCCCATTGACGAAAGGCAG
CATCCTCAACCTCCAGTCCATGAAATCGCAGTAACGGCTTAATCTGCTGGAGCCTAATACGTCGAGTCTGCTGTACCTGTGGATCGAAGGTAACTATGAG
CTTTTCGCACGCAGCCATGAACGCTAAATGACGCTTTCCACTGCTTTGTGGATCTTCTGGTGATAATTCCAAAGAGGATGGTATTATCGTTGACAATGGG
GACGATCTTGATGCGGGGCTCTCATATGCGTGTGGACGCCGATCTAGCTGCTTTGCGTAAGGCTGCGGACGCTGCAGCATGCGCTTCACGAGTTCGCGAT
CGCGTACTATCGCTCCTAAGGTTTTAATTGCTGCGGTTGAGTGAGGCTGGACGAGTGGCACAGCCTGGCGGTACAATTCGAGCATTCTATCGTCGTCCTT
GTGAGACCTACTTGAAGattcgaagctgctgccatcgtcaCTTTCTGCGGGATCATCGCCGTTCTCAGACCGAGACAATTGGAATGCCAGAAGACATTCT
ACGGATGGAGATGTCGTCTTCATTGTGTACTTCTCGGTTTGCGTGGTGAAAATTCTGCTTGAAAATAGATACTAAATGCTGATTGGTTCAttttgttgaa
gtggagctacATGGATACAAGATGATTCTCGGTGCAATGCACATGTAGTTTATCAAATTAGCGGGTGCAGTATAGTGGGGTCACTCAGCATACTGTGGCG
GATTCCGTAGCACAAATACAGGACGAGGCCTGCGCTCAGCCAGATAAACACACCAAGCCTAAAGAACAGGTGCCATGTTAGCCTCAAAACATAGAATAGT
TGTCCAACCAACATAACTTGCACGTACCATCCCTCACCAGGGATACTTGACATCATGTACACGTTGGCAAGAATACCCATACAGGGAACCAAAGGCACCA
GCGGGCATTGGAACGAAGTTGACAGATCACTGCGAAAACAAAAATTAAAAATTAATGTTCGTAAAGCCAATTGAAAGTTGATTTCGAAAGAAAAAGTATG
GTGCGTACCCGAGTTTCCCCAATCGGTAGATAAACACGAATGTTGCAATCACCATCATCGCGAACGCGCCTTGAATCGTCCACGGAAGATCAAACACGAA
AGACAGCGACAGAGCGAAGCATGCGATCACGAAGAGGAGAACACGCTGcacgacaccagctccactgAGACTCGGGCGCATGCGCAGTAGAAGCACTCCA
GCATTTACAAAGGTGAAGACTTGTAGCGTTCCGCACGAGATCACGTTGGCCAGGAAGTCGAGCTCGAAGACAAGCGCTATGGACGCCACAAGAATTCCCG
TAATGATAGTACTGGCAATGGGCACATGGGTCCGGCGGTGCAGCTTGGCGAAAAGTGATGGCAACAATCCATCTTTTGCCATCTGATAGAAGATACGAGG
CTGACCCATAAGGCAGGTAAACGCTGCAGTGGTGAGCCCGAAAATGGAGCCGAAAGACACGACGCGTCCAGCCCACGGTGCGTCATGAAAAGAAAAAGCA
TTCACCAACGGAACTTCGCTACCAAGCACGTCTACAGGTG