Description :
From Genome Similarity Track
Location :
Scaffold_735:6486- 12475
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_735-snap-gene-0.6Voltage-gated Ion Channel (VIC) Superfamily
Pytap_DAOMBR444maker-pag1_scaffold_735-fgenesh-gene-0.2Pseudouridylate synthase
Pytap_DAOMBR444maker-pag1_scaffold_735-fgenesh-gene-0.0Mitochondrial Processing Peptidase alpha subunit
Pytap_DAOMBR444maker-pag1_scaffold_735-fgenesh-gene-0.3Nonmuscle myosin heavy chain b

Sequence
5989 bases(100 bases per row)
GCGCGGTTTTGGAGCATTTCGAGGTCATGACGGAAACGCGCGAGCTCATCGTCTTCGAGGGTGCCGCTATTATCAGTGTCATAGACCTGGATAATGTCGT
CAATGTTGAGGTGGATATCTTCGGTCACGGCgTGGAAGCGCTGTAGGATGGCTTGGATCTCTTCCCTGCAGATCTGCTTCTTCCCCTTGAGGTAATCAAC
GTTTGACTTCATCGTCTGCTGCATCACTGTCTTCATCACTTTCTGGAAATTCGTACCGATGACCGTGATGGGCAGCGCCAAAActAaCATACCCGTAAGG
ATTGTACACATGCCGACAATGCGTCCTCCTACCGtcACTGGAGTCATATCGCCATAACCAACCGTCGACATCGTCACTATGGACCACCAAAATGACTCGG
CAATGCTGGAGTACGGGTTCGGGTCCACACAAATGCACTGCTTCGTGCCTTCCGGTCTTGTCATCGACGCGCCGGTAGCTGCAGACTGACCAACCGACGA
AGAAACGACATAATTGGTTGTGTTGCCATTGCAGTCACCAATCCAACCGCCTCTCCGACATCCATCAGGGGTgTACTCTGCAAAGTaTATGGCGCTTGAG
AAAaCAaCGACAGCGATCCCCATCAGAAACACAAGCATGGACAATGCCTTGATGGAAATGGCGATGGCTTGGATGAAGATCTGAATCGCTGAAGAGTAAC
GGGACATCTTGAGCACACGCGCTACTCGTGTCagTCGGACGATACGAATGGCACCGAAGCTACCAGCGTTGTCAACCTCGAGGAGCACTTCGAGGTAGAA
GGGGAGGATCGTGGCGAGGTCGATCCAGTTGCCAAAATCTGTTGTCAAGTTGTACATAACAAGGTCAGTGGCATTCATAAGCGAGGATCAAACTGGAGGA
ACGCACTTCTCATGAAGTCGCATTTGCTGGGCGAGGACAGCATTCGCAGTCCGTACTCGACAGTGAAGACACCGGCACAGACAGTCTCAAGCGTGTCGAG
CGTATAGCGATAAGGGTCCAGAGATTTGTCGGTCTGTGCGATGAACACAGCAGTTGAAAGTGCGATAAAGAAGAAGAGGCTGATGGAGAAGTAGTAAGCA
CCGAGACTCGACTGGGGGTCGTCGAAGAAGATCCACACGCGATGGCGGAGGGTGTTGGGCACCACGAGACTAGCATCTTCGCTGCACTGGCTCATGTCGT
TGACTCGAGACCCAGAACGGACAACTGTCAGGGGACGGGTGGGGCCACCAAGAGATGATCGTGGAGATGCGGATATCTTCGACAGAGTCCCACTATGTAA
TTCTTCAGTTGTAGGCGCTACAGTTtCTGTGATGGGAGCGATGCTTGCTGTTGATCGCTTACTTCGGAAGGGACCAGAGGAGGAGGAGGAGATAGACGAC
CGAAGATGAGAGCTCATTCGTCGGAAGATCGGGAAGTTCTGTTCCACGCGAAACACGGTGCTGCTTCGAAGAGCAGAGCGGCGCTGAGCTTCGCGTTCGA
TCACCCGAGAAAGCTTGAGGGCAGTCTCAGATAGTTCATATGCCGGGACGACGAACGCTGTCGCCATCCCGCCTTGATAGGACgCTGAGACGCTGTCTGA
CGGTATCATGGGACTAATGGATCGAGCGGACCCCTGTTCTCATGCACTTTTGCCCAGGGCTGGGCAACACCGCAGACGGCAATGACAACGGCGAAGACGA
TTGCAAAGGCGATGCCGTCGTCACAGCTGAACAAGTCTTTTtCGGCCCCGCctGCATCAAAAATACAACAGAAGTAATTGGtATTtGGCGCGCAgTCTTC
CTAACAAAGCGTTCCATGCATCTATTTAttgtcacgTcaccTGAAGCTACCGGGTTGCTGGTATCAAAGTAGTTGTCAGTGGCCTGGCAACTCACTCCGA
GTCGGCGTCCGACTCGACCTTCGCCTCATCTTGCGCGTCCTGCTCAGCCGTCTCCGTCGTCTCCTCTGACTCAATGACAGCTTCTCCTCCTTCGGCCTGT
CGTTTTCGCATCGCCTTCTCGGCTTCAAGCCGCTTGCGGCGGTTCTGGATGCGCGACAGCTCTTCCTTCTCCTTCTTCCACTGGGCCAGCGGACGTGACA
CGTAGTCAAACGGCAATGCGCCGAGCAGCTTGATCCACTTGGCGTACGTGCGCGTCTTGTTCTCGTGCTCGATGATGTGCTTGAAGATGTAGTCCTTCTT
AAaCTGCTCTACTTTCTCGCACACGCGCTCGtCCTTTGTGAAGTCAAGCGgCGgATGCGACACCTGCACCGAGTCCTGGAGCTTGCTgTTGTAAATGTCA
AAaTGCGCCTGTGCGAGGTACAGTCCAACACTTGGCGCCTTTGGCAGGTCCATCTTATCCAGTTCCATGGCCTTGgAGATGGTTTCGATTGGCGTGATGC
CCGCGACGACTTCAACGGCAGTACCAATCATCTTGCGGATGTGGTGGAGCAAGAAGCtctGGCCCAGCACACGCAGACGGATCCACTCCATGTCGTTCTC
AACGAATGGTTtGTCAGCCGCGAACGACATGATGTAACGCTGACaCTTGGGGCtcGTTGGCTCGAGCTTGGAAGTGAAGTTGTGGAAGTTGTGCGTGCCC
TCGTACTCCTTCAGCACGCGTAGCAGGCGATTGtACGtCTCATCGCTCATGCGGTACGaGCGCTGCTTCGcGAGCGTTGATGTGTCGACAACCACTGCGT
TCTCCTCGTCAACGTTGTCGCCGTCGCGGTCGAGCATGTCGAGCGACCACTCTTTGTTCAATCCAGCCGCGTCCGTACCCTGAGCATCGCGTGGTGCGAA
AATGAACGTCGGTGCGAGGTACTCGTACGTGCGCTTGTCACAGCTCATCTTGGCGTTGAAGTTCTTGGTGGTCGTGACCATGTCCATGATGCGGATGTCC
TCTGGCAGGTGGCtGTTGGTCTTGGCCATGAAGCcTtCTACGTCGTCTCCCACATGCAGCTTGGCCGTGACCATCTGCCCAGCCGCGTGCACGCCCTtGT
CCGTGCGGCCTGCACGGCTCCACCCGATCTTCTGCAAGAATCCGTAGTTGTTCTCCGTGATGCCTCCGgCTTCGAACAGCCCGCGCTCGAGTTCAGCCTC
AATCGTcgCcACGCCCTCaTTCATCTGCATGCCCGAGTACTTCTTTCCACAGAAGGCGACCCACATGCCATAGCGGCGCTTgcTTGGCAGCGCCTTAGCC
TCTTCCGTCGCCGTCTCGGTCGCTAGCGCCGCCTCTCCCTTGtCCTTCTTACGCTGCGCAGCGTACGATCCTGGGTGGATCTCCTCCGGGAAgCCTGCGC
GACGGTCCACGAACTCGTTCTTCTTAGGAGGCGCGTCCTCGTGCCCTCGCGCCTTcTTGGTCTTGCGGCGCACCGCCCAGTGCGTCTTCCGCTTGCCTCC
GCCGGCCATTTtGGTtCTGCCCCATGGCGCTTCCAGTGGTTCtACGCTGTACCATGTAACCCGGTACAACATGTCACGTtGGACTCAACGGTGTGTAGTC
CACATAAACTAGAACCTTAAGATGTACCATGGTTTTGGTACACTCgCTcgCCACCCATCAGCACGCCACAACCGCGTCAAAGCGAAGAGCTCCGAAGCCC
GCtAGAtccccATCATGAAGCTGCTGCGTCCGTCGTtCCTGCGCCGTGCGACGGCGCTGCGTCGCTCCACCAGTGctaCATCTGCtcGCGgTGTCCGCGC
GTTCTCGATTGCGGCCTCTACGGGCTCTGGGGACGCCGAGAAGCCCGAGATCTTGCGACCGGAAGGCATCGATAAGGCCAAGAAGCAGTACTCGCTGCTT
GATGAGCTCCCAGGTCTGCCACAGCTCAAACCAGCGAGCCAACTGCAGGCACCGCAAACGGAGATCACGACGCTaCCGTCGGGACTGCGCGTGATCTCGC
AGGAGACGTACGGTCAGGCCGCGACGGTCGGCATTTTCGtGGATGCCGGCTCTCGGTGTGAAGACGCGAGTGAAGTGGGTGTGACGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAAGACGCGCTCGCATGCGGAGCTTGTGCGTGAGATGGAGAGCATCGGCGCGCT
CACGACGGCGTCGTGCGGCCGTGAGCAGATCATTTACACGGTCGATGTGCTGCGGGACAACGTGgAGAAGGCAGTCGAGCTGCTTGCGGACTCGGTCCTG
AACGTCGAAATTACGCCAGAGGAGATCGAGACTATCAAGACGATCATGCAGTACCAGACTGAGGACCTGATGGAGAACCCACAGGCGCTGCTTCAGGAGT
ACGTgCACCTGGCAGCCTACGGTGGCGACCAGGCGCTGGGACGTCCTCTGCAGTGCCCTCTCGACCAAATCAaCGCCATtACGCTTGACAAGGTGCAGCA
GTTCCGTAAGAAGCACTTTGTGGCTGAGAAGATGGTCCTCGCGGGTTCAGGCATCGACCACCAGACGCTCGTCAAGATGGCTGAGCGTCTGTTCACAGGC
GTGGTCTCGTCGGGCGGCGCCACGCCGGGCGCGTCCCAGCCAGGACCAGTTGAGTACCGAGGCGGTCTGCATACGATTGACAACCCGGAGACgCcGTTCT
CGTACGTGGCTCTGGCaTTTCCAACCGGTGGCTGGCACCaCGAAGACCTTGTGCCTGTGTGCGTGCTGCACACGCTGCTGGgCGGTGGCGACAGCTTCTC
GGCTGGTGGGCCAGGtAAGGGCATGTACTCGCGCCTGTACACGAGTGTGCTCAACCGCTTCTACTGGGTCGAGTCGGCCTTTGCGTTCTCGTCGATCCAC
GCAGACGTCGGTCTGCTGGGCATCTACGGCGCTGGCGTGCCATCCCACACGAGCAACCTCGTGGCGCTCATGCTGAACCAGCTGCTTCACATCGCCAGCT
TCAAGGTGGACGAGCAGGAGCTGCAACGTGCCAAGAACCAGCTCAAGTCGAGCGTACTCATGAACCTCGAGTCGCGAATGATCCTGTACGAGGACATCGG
CCGCCAGCTGCTCACGTATGGCACTCGTGAGTCGCCCGAGTCGGTGTGTgCGAAGATCGACAACGTCACAGCCGACGACCTGCAGCGTGTGATGCGTGAG
GCGATGAAGCACAAGCCGAGCGTCGTGTACCACGGCGACGCTCGTCGCTtCCcAACGTACGACCAGGTGCTCAAGGGACTCGAGGAAGGATTGAAGAACC
TGCAGTAAGCGAGCTGTAGAaTGGTATAGATAAAAACacAATCAGGCACACTCTGGGATTCAATGCGGCTTGTGGACagCTCCTACGACCGACTTGGTTt
GCTCTTCATCAAATCGACGCTtcTCAGCTGCTTCCTCAGCGAGCAcTTGAAAGCCGCGACGCAAGTACATCGCTCGCTCGCGGTTCTCGACTTCAAAGTC
GAGCGTGCGGCATGGCACGCAGAAGACTAGCGATAGGCATCGGCCAGGGACTTCAGGTCTGTGGTGCTGGAAAGTCTCGGTCTTGGCACCAAGAAGAACT
TCCACAAGCTCCATGATCTCGGCAGATGCACCGGCCTTGGGCGCCGAGGCTGAGTCCaGgACGGCACCCGACTGCCGCCACGTGATCCACCGACACTGCG
GGTCCGTGTGCAAAACTCTGACGTGAGGACTGCCTCGAGTGCCGTACTTGATGACCGAGATCCCTTTCACGAGTTGTTCCTTGAACTGCGTGAGGAAGAA
CTGCTCCTTTTCGTGTTGCTCCAGCTTGGCACGTGCGTTGTCTTCGAGCACCTGTAGTGCTGCTTCGATCCGAGCTTTCGCGTCTCGTTCAGCATCCAGT
TGCATGCGCAACTCAaTCTGGTGTGGATCCGTGCCCTCGTGCAGTTTGTTCAGAGCCTCTCGCTTGGACTGCTCCTCCTTGAATCTCTT