Description :
From Genome Similarity Track
Location :
contig_5:648539- 649832
Sequence
1293 bases(100 bases per row)
ACCTCGGCTCATTGGGGGTCGCAAGAGTGGTTCAAATCACATAAAATGTATTGACTGTGGAATTCGTGTTCTTGTTGGTGGACGAGGAAGTCAACAAACT
AGCTCACCAGAAGATTCAAACAGCTACCCGTGCTGCGGAGCCAATTGCGTGAACGTGTTTTGTTCTTCTTGCTACCACCTACTATCAGCAAAAAACAAGC
TGTGTGAAGAATGCTTTCAGCATGAAATAACCCCAGAAGAAACCTTTGGCGAACAACTTCGCGTGGTGCTAATTGAGAAAATTGGCGCCTCCGACCAGCA
GCGAACACGGTTGGAAGATATATTTCGGTCTTTCGACGTAGATGGGTCGGGTGCACTAAGCCCGCAAGAGTTTGAGAAAATGCTTCTGCTTTTGAATGTC
CAGCCCCCTCTTACTCAAGGACAGAAAACCTTTCTTATTGACCAATTTGATGCGAATGCTGATGGTGAGATCAGTTTGACTGAGTTCAAACATTGGATAC
TCAGAGACCGGGTGTGGGAAGAATCACCAGCGTTGCCTACAAACCCTGAAAATAAGACCCATACTGTAGCAGAGGCCTTCGATACTGTCATCAGTCCCAT
ATGCGATGAAATTATAGACTTGGCATACAACGCACATGCGTTCAGCTCTACTATTGGATCCTGGTCCCGCTCAGCAAACTCGATCTCTGAAGGCCAAATT
AACCCGTCACAAACAGGAGAAACTGGAACTATCCTGTTTCAACGAGTTATCAGTCTTGGTATTGCTTTAAGTGCAGCAACAAATGCCGCTGAGAAGGTCT
TTGAGCAGGTTGACGGTGACGGCAGTGGGATCATCGACCAGTATGAATTTGTAGACTTGCTTTCAGCCTTGGGCATTCATCTCCGTTTTGAAGATGCAAA
ATTGCTCATGAATCGTTTGAGTGCTTCACCAGTAGGTAATGGGAGCAGTACAATTACACGGTCTGCCTTTATTGCTTACGTTGAACAAACCAATATACAA
TCGCCAATCGGTAAAACTGCAGTTGGGCTAAGCGAGGTGCTGATTCGCCTGGATGCGCTTGCTGGGTCTGAAGCTACTGTTCGAGATATTTTGCAGAGCG
AGTGCCAACGACTACACGAACATATGAGCGAGAAGGACTTGCTGATGGTTTGCAAGGCTCTTGATGAGAAAACAGGACTTGTCATCGGCGTGGATGAATT
GCATTCTTTGGCCACCAACCTATCCCTTCACTTTGAAGCACCCGTGTCATCCTCGAACTCAACGGTGGTTGACAGTAATGTCCAATCGATATC