Description :
From Genome Similarity Track
Location :
Scaffold_60:64852- 66862
Sequence
2010 bases(100 bases per row)
TCGAGTGTCGACGACGGCGGTGACCAGCGCGGCGCAGATATGTGCGACGCTCGCATGATGGAGCGCATGATCTTCTCGACTGCAGGACGAGTGCCTGGTT
GCTATGTGTGGTGTGAACTGCTCCAGTCTGCGGCGCCGAGCTTCGACCCGACGTGACCTCACGTCGTGAACGCACAGCGGTGCCGCAGTGGCGAATGCAC
AAGCACAAGCACAAGCTCCAGTCCTGTCACCAGACTCGCGACGCGTGCCAACAGCGTGCGCTGCACTTCAACTCCCAGAGTGGTACTGCATGCCTGGTTG
ATTGGCGCGCGCGTGTCGGCATCGTCTGATTGGGTGAGTGGCATAAGAGTGAAGGGTGTGGCTTGTGCGGAGACTATCGCCCCAACACAAACAATCTGGC
CGAAGTATTTGCACGAAAGCTCTTAGCATTGGCAGTGGTGGGTGAATTGGCATGCGTTGGGAAACGAGTACAGATAGCGTTGCTCAGATTTGTTGTTGTC
GGCATGTTTGACAGACTCGGTGTGTACCCCTGCTCGTGTTCGCTCTGCACACAGTCAAACCAAACGATATCACCGAATTCTCGAGTGTTGTGACTCGGTT
TTTGCACGGCCGACCCACAGTTGCACTGCTCAGTCGGTGGAGCTGACGCGCAGCCGTCCAAGATTGTCTTGGTGCTGATCGCGCTCGCTCAAATGGCTCG
AGATTCTTGCCGCCCGTTGGCCACGCGATGTATGCGGACGTGCTGCCGATCGGAACCTGATCCTGGTCGAGGCAAGCGGATCCGCTAGATGTCCACAGGA
AGCAAATTTGCAAATAGTACTGAGTATACTATTTTATTTCGGACACCGACGTGCGCGCGTCACAGCTATCGCTTCAACGTCAACTAGAAGTTGCAGCGCC
ACGCATTCGTGTCATCGATTGCTCAACTGGCCAGAGAGGTCGTCATGCACGCTAGCGAAAAGAGAGACGAACTCAGGTTCCGTCACCACGGCGGGCCAGT
CTTTGCCAATGTCGAGGCTTCGTGGAAACCGGCACCTAGTCCATGATCGAGCCCAGCTCCATGTTCGGTGGTGCTAGCTGCGACGCCACCGCCAAACGCC
TCGATGCGTGGTGAATGGACAAGGCGATGCCATTGATATTAGTGGGTTCGGTGCCGCAGTCAGTCAGGGTCGTAAACGAGCACAAAGACATTGTCGAAGT
TACCACCGTACCGTACGGGGAAACAGAGGGAAAGCAGCGCTCCTGTGTGTGCACGCTCCCAGGCGACGACGCAAGGGTCGAATGTTGGATGGGGACGCTA
AAGGCGAGGAAAAGCGTAACGCGGCGAAGACATGGCGCCAAGCGCGAGTAGACATGCAGGCTAGGAGGAAGCACGAGCAGGATCGAGCAGGTGACGCGCA
GATGCCTGGAGCTTCTTCCCGCTGGACTTCATCCATGTTCAACCGCAGCCGATCTTAGTGCAATTGTGTGAGCAGCGAGGTCGCGACCAGTGTCCTATAT
GCACCGAGTTCGGTCACGATGAGTGTATTTGGTACAGGAAGGTGACAGCTCATGTGTGGAGTTCAATGCACATGGATGGCCATGTTGCATCCAGGCGATA
AGGACGCTATCTCTACTTGCATGTGAGAACCCCATTGCGGAGCAGCGTCAAAGTCCCATTCCCATTCGAGTTTAGTCAAGAGCAGAATGGATCAAGTGAT
TCAGCGCCACCGTGCCGTTCACATCGCCACACTCAGAGCTATGGTCGCATGGATGCAGGCGATAAATGAGGGGAGGCACACGCCGGCGTGGTTCCGTTGG
CTGATCCGCACGTCGGAGGTGTGCCGAGAGTTCTGCGCGATCGGCAGGCGTCTGCTCGATGGACTCTCGAACGGACCGCCAGAGCGGGCGATCGACGGAG
CGCACGGCCAACCGGACGAGCGCGACGCGACGCGACGAGTCGGCTACTGCGCTGGAACTCGAGCTGACTTGCCTTTCAGAGCAACGCAAAGATATCAACC
CTGGAGATGA