Description :
From Genome Similarity Track
Location :
Scaffold_74:6485- 10653
Sequence
4168 bases(100 bases per row)
GGCGAGAGGTGACACTGCGTCGCGGGGAGTCGTCAGGGCCTTCCTGGCCTGGGCGTGTGTCACTGCGCTAACAGTCGCTGAAGATGAGGCTGCACTCGAG
GAGGAGTCGGCAACCGGTTGAGGGTCCATTACCGGTGTTGGCGCAGAAGGCTTGTCGGCAACCGGTATGGTAACCGGTTGTGGGTTCGAAACCGGAGTTG
TCACAAAGTGGTTGTCGCCTCTTTCACCCCCACCCAGAGTGGAGCCACACGGCGCCGTGGGACGGCCCACGGCGAGGAGAGCTGGAACGCGAGGGTCCGA
GCGTTGTTGACGAAGAAAGGAGTCAAGCCAGTCGACGCGTGAACCGCGTTGTTCAGCGCGAACTCAGCAAGCGGAAGGAACGAGCTCCAGCTCGTAAACG
ACGTCGCATAGCTGCGAAGTACGTCCTCAAGGACGCGATTAACTCGCTCGGTTTGGCCATCCGTCTCCGGATGAGCGGCCGTCGACATCAGCAGCTTTGT
CCCTGATAGCTCGAAGAGCTTCGTCCAGAAAGCAGACGTGAACCGCGGATCGCGGTCCGAAACAATGGACTCGGGCATGCCATGATGACGGAAGACTGCA
TCCACGAAGTGCACCGCGGTATCGGCCGCGGTGATCGTATCCGGGACCGGGATGAGGTGAGCCATCTTGCTGAACCTGTCGACNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCC
ATGTGGGGCAGTAAAAGTCGCGCGACACTGCGGCGTATGTCTTCTCACGGCCCAAGTGAGCGCCAAGGGGGATATCGTGGAACTCGTGGATGATCCGCGA
GCGCAAGTCAGGATCGTTGGGAACCACTACACGCGAAGTCCGAAGCGATCGATGCTGTACGTTAACAGCCCGTCTTCAATCCGATACCTATCGATCTGAT
GGCGTGTGGAGCGGGGACAAAGCACTCAGTGTCTTTTTCACTGGGCGAGCGGAGATGTTCCAGAATACTCAAATAGACCGGATCGAATTCATACGCAGTC
CCGGATTTCGTCGCGGAGTGGGTTTTCTGAAGACACGCTCGTCAGGTTCAATCCCGACGCCAAGCACATAGCACAGTTGTCTTCGTCGTCTTCATCATGC
AGCGGTTGTCGACCCAGCGAATCGCGTGGGTCGTAATCTGGACGACGAGACAGAGCATCTGCAAGGATGTTGTTCTTGCCGGGTTTGTAGTGAACCACGA
AATTATACTCGGAGAAGAACGACAACCAGCGAGCCATTCGCTGGGAAAGATGAGGGATCTTCATCGCTGTCCTCAGCGATGCGTGATCGGTATACACTGC
GAAGGTTTGCTCGCCGAGTAAGTACACTCTGAATCTGATCAGAGCGTAGCGCATCGCGAGAAGCTCCTTGTCGTGGACAGGATAGTTGCGCTCCGCTGGC
TTCATCTGTTGAGACTGATAACTGACGACCCGTTCACGTCCTTCGTCGTCAAACTGCATCAGCGCACAGCCGATGGCAAAGTCGCTCGCGTCGCAAACGA
CGTGATATGGTTTCGAGTCGTCGGGAAGAGCTAGGATCGGCGCCTCAGCAAGGCTCTTCTTCACTGTGTCGAAGGCGGCTTTATGCGCGGGTGACCAGAC
CCATGTGGCATCTTTCTTCAGGAGTGATGAGAGGGGCTGGATCAATCCGGCGTAATTCTTCGTGTACTTGTGGAGATAATTTGCTAGCCCCAACCACTGA
CGCAGCTCAGTGGGGTTCTTTGGTGTCGGCCATGCGCAGATAGAGGACACCTTCTCCGGGTCGGCGCGAACGCCGTCTTTGCCCACGAAGCAGCCCAGCA
CCGGAATCTCCGGCGCGCAGAAGATACACTTCTTCAGGTTCGCGTACAACTTGTCCTCGCGCATCACTTGGAAGACCTGTTTTAAGTGCCTCAAGTGGAC
TTCTATTGCGCTGAGACCACCCTCAACGCGGCTGTGCACGAAGATGTCGTCGAAGTAGCTCGGGGCGACGTCTCGAAGCGGACGCAGCACATGGGAGACC
ATGCGATTGAACGTGGCAGGAGCATTCTTCAAGCCTTGTGGCATCACAAGCCACTCCCAGAGCATACCGCTGGGGGTGCTGACCGCTGTCAGGCGAATAT
CGCTCGGTCTCATCAAGATCTGATAGAATCCGTCGGTCAAGTCGATGGCTCTGAAGACGACACTGCCCGCCATGGTGTCGAGCACCATGTCCTTCCGGGG
AATTGGGGTTTGCGCGGGGATGGTCGCATCATTCAACTTGTTAAAGGCATGAACGATGCGCCATCCGCCTGTAACCTTCTTCACACAGAACGTTGGGCTC
GAATGTGGAGAGACACTCTCACGCACGTGACCCGCTTTACGGCGATTCTCGAAGAAGTCGTCGATGGCCTTGACTTGGTCTCGCGGCAGTGGCCACTGCC
GCGTCACACAGTACTTCGAACCGGGCGCGAGATCGATCTCGTGGCGGACGCCTCGATCGGCAGGCAGTTCGGCTGAAATCTTATCGGGGAAGACGTCCGC
GTATTCGCGGACGGTCTCGTACACTGGATTACCAGACTCGCGCAAGGACTCCCAGGACTGCGCTGCGAATCGCTCCTCGCGAGCGGACTTCGGTTCGGCG
CTCTTGGGACGGGTGGATCCGTCGTCATCACTGACGGTGTTCCCTTCGAGTGGCGTAGACGAAGTGTCTGTGATCAGGCAGACCTGCTCAACCTCACCAA
CCTTGAGACCACGAAGGAAGTTCTTCCAGGAGAGACCTGGAAGCCGGGTGATCGATTGAGCGTCGCGAGGTGAACACACAAGATCGACGGTGCGCTGACG
GCCCATGCCGTCGTCCACGTGCTCAATGACACAGACCGACTCCGTCTGTGAGATGCCGCTCGGTGCAGTTTCACGTCGTGGCTTCAAATGACGGCGCTTC
GACTTCTTTGCCCGTCGCCTCGAGTGTGTACTCGAGGAGGAAGAATCGCTCTCGCTGGACGATGTATCACCCCGCTCTAGGCACTGAAGCTCACTCTCGA
CTGTGCCGGTCACACGCGGGGGCCACTGCTTGACCGCGTGGTCGTTCGGCGGGAGTCCCAACTGCTCGACCACCGGCTCGGGTGACGGGAGCCTCGACTG
CTCGACCGCCGTGTTGCATTGCGGGAATCCATGCTCGACCGCCATATTGTGCTGCGGGAACTCATGCTCGACCGCTGTGGTGCGCCGCGGGAACCCATGC
TCGACCGCAGTTGTGCGCTGCGGGGAACCCCTGCTCGACCGCTTGCTCGTATTACAGGAGCCCCTGCTCGACCGCCATCCGTGTTCTTTGCCCTCGCCTC
GCGCGAGAGCCTTCGTGCAACAGCACTGCGCAAGCGATGCAGAGAGGGCCATCGCTCACTCTGTGTTCAGCCTGCGACGTGAACGACCGGTCATCGACGG
GGAACGTGGTGCCAGGTCCCTTCTTGGCCAACCAGGAAGCTGCGTGAACAACTTCGCTCACGTCCGAAACCCGCTGCGTTTTTTAACCGAGCGGGCCAAC
CAGGCCAATCCCTGGCTGAATACCGTGACAACCACGGGATGCCCAGGTTGGCATTCAAATGCGTAGTTCATTCTTTATCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN