Description :
From Genome Similarity Track
Location :
Scaffold_46:64826- 67713
Transcript NameFunction/comments
Hyaar_Emoy2806086hypothetical protein
Hyaar_Emoy2806087hypothetical protein

Sequence
2887 bases(100 bases per row)
CGGACGTTAATCTTACGGATTGAAAAGGAGGATTGAAAAAATTCGTTTTCATGACATGGTGTTTACCTGGATTTCGGGCTCAGAATCGTCGAGGTGGACA
AAAAGGCAGTCCAACGCGTAGTCGATGATAGGTCCTTGTAAATGCTTCTTTGGCGCTGTTTTCAGGAACGTGGCAAACGTCTGGCAGGCGGTTTTCCGCA
CGATGTCGTTGCTATCATCCAGACGCTTCAGTATCTCAGAATACAGCTGCTGAACAGGTTCCTCTGTCAAAAATCCAAATCTGTTGTCAGAACTAAGTTG
CGTCGAATACAACCATGGACGCACAACTTACCTCCCAGACAGCCGGGCGACGCCAGAAACAAATGCTGCAGCGCAAGGCAAACTAGCTGGCGAGTTTTGG
CATCGCTGTCATCTATCGAAGATCGCAGTACGAGTAGCAGCTATATGGAAGTAGTGCCACGATGCGTTCATTAGCACGACTATTTGCTGACAAAAGTGCA
GCAACGACAACAATCACCTGGGGCGCGGTCTCAGCGAGGCATGACTCGTCGACGATACCTTGACGAAGGCAGGTACACGCACAAGCGACGGCCACCTTTC
TGATTAACGAAGTGCAATCATTATGAGTGTTAGCGGTCCACGAGAACGAGCTCATCCAGACGTGTCTACTCTACCTGATGGTTGCAGCTATACGCTCTCC
ACGGCAGGCAATGTTAGGGATTATTGCCTTTTGAAGTAGTACCACACGATACGATTTCAAGGCCTGAACCCAGCACAAATCTGTCAAATTCTGCACCCTC
GAAAATGTGTTAATGAACATGGCATACCAGACCGGTCGTATCCCTCTCCAGCATTGTCTTCAACAATGCAAGGAAAGCAAGCCGAACATCTGCGTCCTGA
GCTGGTTCCAAATGCAACACAAGGACAGGCACAATTTTATCTAGCCTCTCGAAACATGCCTGAGCATAACATAAGCGTAGATAAGTCGGACAAAGGCAAA
ACCGATTCAGCGCTAGCACACAAACGTTTCGCACCATTCCTCCGCGCCGGCATAGTGAGTCAAAGAGTAGTCGAGTTGGGTTATTTTTTTGCCAGCTTGC
AGCTGCATTGGATGGCAGCGCCATCGCATCTATCAGTCTACCCATATAGCGGGTGTAGAGCGTCTACGGTAGAAGTACAGTCTCGATCTGAGGAACAAAC
TCGAGAAAAAGATGTATCATAATTGACTCACCTCTACCGGCTGCTTCATGTGGGTCGCAAGCTCGTTCATGCATTTACTTGCCTAAGACCACACAATAGA
GAGCACGCACTCAAACATAAGCCAATTTTAAGAGGAGCACATCGCGTCATAGCAAGTTTACCGTTTCACAAGCAACCGATAATTCAGACGATGAGGCTAG
AAGGTGGCTCAATACCCAGAATATACGGAAGCAACTATCGTCTTTGTGCGCAAGCATCGATCCGGCGGTCTTGACAATACTAGCTACAACCCCAGCCAGA
TTATTCTGGAGGTCCGCTACTTCGGATTCGCATAGACCAATATCACACAGTGCTTCAGTGATCGACTGCAGAAATTTCAAAGCGTAAAAGCATACCAAGT
TCTCAGACCTCTAGAACAAGCTGGTTCAATCATTGCAACCTTTACCTCCAAGTGAGCATCGATAGTTTGCTTCATCATGCCTTCAATACTCATGCGCAAC
ATTATCAACCCGTTTGTGCGGTGATGTGCAGAATCCTGTCCTGCTTGCTTGCCTGCTATCATAGGACGCAGGGAGGCCAGGATCACTCGGGGGTCTGTAT
AGAAGCCAATAACGACCAAGCATGCTTTTACACTATTGCAAACAATTTCTTCGTCGTCACGGCACGTCTTCCCTATCGCTGCAAATACTTCGTCGAGAAA
TGGGTTCATAATTTGCTCCAGCAAGATCAGGTACGCAGTCAGTACTTGTGTGTAGCGTTCACGCACTCGCGCAGTCCAGTCTCCAGATTTTTCGAGCAAA
AAGGGCAACACCTGAGCTTTGATGCTTGCTGCAAAATTGCGAGCCCCAACCGGTGGGCGGGTGTCAAAGAAAAATGGAGGGATGTTTCTAGCAGGTTCTG
AATCTACCTCCATCAGCTCGTCCCCTGACCCAACGCCTCTGGCCTCACCGCGACTCTCCCAAATGACTGATAGATCATTCAATTTAGCAAGACATAAGGC
ACGCACATCGGGCGCATCATCAGCCACACCTGCTAGAAAAATAGGGAATACAGATGCTTCAAACTGCTCAATCTGCTCAGACTGGGCCATCCACGTCGCC
AGCGTGATTACTAGCTGCTTCCTAACGGACGGCGATTGGTCAAGTACCACTTTGCTTACCGCCGGCAACAGTAACTCCTTCATAAGATGTTGAAGAGCTT
CTGAGGCACAGGGCACTGCTGCTTCAAGTGCCTGCAATGCACATACACGCACACGACTGTGCTGGTGACCCAAATTTGCGATCATCGGCCGAACGATAGT
GCCAATTTGCAAGCGCAGGTCGTGCTTCCAAGTGCGAGCAATTAATATGACGCATTCTGCTGACATCTTCTTTGCGTCCGGGAACGGATCCACAGCCGTC
TTGCTCAGCGTATTGGCCAGCTCTGTAATGACGTCTTGCAACGACGTTGGCGTACCATATACTGCTGCTAGCTGCTTCAGGAATGCATACAGCAGCTGCA
GAAGAAGCAGACGGATCTCTTCCGTGGGCTCGGGGAACGGGAACGTACCCAGTCGAGCGTCAATCAGCGCGACAACTTCTTTCAGCGTCGTGTTCGACTG
CTCTAGCGCCCCATGTTCACACAAAACCAACAGCAACCGAAGCGCTTGCTCACGGCATTTCTCTACAACGTCACGCTCCGCGCATTG