Description :
From Genome Similarity Track
Location :
scaffold_28:6482- 8902
Transcript NameFunction/comments
Pl_111788hypothetical protein PHYSODRAFT_362512
Pl_111789conserved hypothetical protein

Sequence
2420 bases(100 bases per row)
CCTTATTGACAGTCATTTCGCCGCATCCCGCAGTTATATGATTGGTTACTCCAGCAAGTCCATGACGATTATTTACGCGTCATCTACGAGCGGTAGTCGG
CATTAATGGCCACGTACTCATGCGTAAGGTCAATGCCCAAAACTTGCGTCTCCTCGGATCCAACGCCTAAATCAATCTCGATCTACAATTACCACGAACA
CAAAATATTAGAAGTGAGGACTTCGAAAACAACAGAGGAACATAAAATCGCTTACCTCGACAAACTTTCCGTGCGGCGGGAAGTTGTGCGAACTGGCATC
GAGACCACCACGAGTGGGCTCAATCAGCATCGCGTCGCGCATGTGTGCTACCAGCTTAGCTTCAATATCGTCGTTGAGCACCATCTCACCGTTCTCGAAG
ATGACCACGCCTCCCATACGGATCTTCATGCGGCGTTGAATGTTCACGTCCTTGTGGTGTAGACCCATGTACTTGCCCACAGCCATGACCAGGCGACCCA
CGTTCGGGTCGTTGCCAGCCACTGCACACTTGAGCAGAGGTGAGTTGACCACCGACTTGCCGACACCCTTGGCCATATCCTTGGACAACGCACCACTCAC
ACGCACCCGCATAACGTGGTGTGCACCCTCACCGTTGCGCACAATGTCTTCACTCAATCCGAGGCACACCTCATGGAGAGCTTTCTTGAATTCGTCTAAC
TGCTTCATGTCAAACGGAATCTGGTCCGACGACACGAGCGTCACGGTGTCTGACGTGCTCTGGTCCGTGTCTACACTGAGTGAGTTGTACGTATCTCCAA
CCACCTCCGTCAGCAATTCACGCAGCACGTCACGGGGAATTGACAGATCTGCATTTAATATCAAAAGTCAGTCCTCCAGTATCAAACTATCAGCAATTCA
TCCCTCACCAGTGAGAATGTACGACAACATCGTAGCCATATTGGGCTCGATCATGCCGGCACCCTTGGCGATACCGACAATACGCCCACCGCACACGTCC
ATGGAGCGAACCTTCGGGTACAGGTCTGTCAACAATGTACAAACATGAGTTTCTTTCTTCTAACACAATATATCCTCAAATACTTACCAGTGGTCATGAT
GCCCTCCGCAGCAGGGAGTACTGAGTCAGACTGCAAATTGTTGACAAGTTTGGGGAGGTTCTCCACCATGGCGTCCACAGGGATGCGCCATCCAATGACA
CCCGTGGAGCAGGGCAGCACTTGGGAGCCTCCCTCCAGTCTCAGATGCTTGGCCAAGTTGTCACAAACTTCTTCAGCATCAGCCACACCACCACCGCTGG
CGCAGACGTTGGAGATCTTGTTGTTGACCAAAATGGCACCGAGTTTGGGTTCGTTGAGACGCTTGCGACCCACCAAGACTGGGGCTCCTGGGAAAGCATT
CTGCGTGAATACAGCAGCAAAGAGGGACGTGGGCTTGACGGGTTTGATGAGGGTCATAGTCATCTTGGCTGGGAGATGCGGCGCCTCTTGTGGCACGAAG
TCGAAGTTGGTGGTGGCGACGGAGAAACCCCATGGCAGGCGACTCTGGTGCGCCTGCAGATAGTCCGTGTACTCGTGACGTGACTCAAATACGAACGGAT
GGCCATGTGTGGACAGACAACGCGTCTGCAGCAACGAGCGAGAGCGGGCAAGCGACGACAAGCGCAAGATCGTCATAGTGGAGCTGGGGACGCGGTTTCA
ATTGTGACCACTAGAGTCACTCTAGATTCGAACTAATAGAGTGTAGGATTTTTCCTATGGAGACAGGAATTCGACCAATCATACGAGCTCTAGGATCTAA
TCTTGGATACAATATACAGTATAGTTTACGGTTTGCAACGATATGAAGGACGCGCTGCCTGATGAAGCTCCTTTGCCACCCCCGCCGCCGCCTCCTCCAC
CACAAGACGATCTCAAGAAGAAACCGACACTGAATCCAAGTCAACCGCAGCCGCTTAAACCCAAGAAGAAGAAAGATTTCCGCGAGATTCTAGCGCTGTT
CCATGAAGAGACCGACGTCGAGAAGACGAAACGCGTGTGGAGCGCCTTGTGGCAGACGACGCTGGCGGAGAGTCAGGAGGAGCACAAGAGACGGCAACAG
CAGGAGCAGCATGGACTCAAGCGCAAGAAGAACGGAGACGACCACGGCCCCATGTCGGTCAGAGGCATCTCGCGTCATGGCAACATGACGCAGGACCATT
TCAAGAGGGCACGACAGGTCTGCAGGAGGAGGATTTCAGGCCTTTTGGTCTTGTTTTAACGACGTATTGTATTTGTAGGGATCTACAGCGAGCACAGACT
CGTCCGAGTCTGGCAAGGGCAGTCGACTGGGAGGACGCTTTCCCAAGAACGTCCCGAAGGGATCGAAACTCATGCAGAAATTCGGAGGCCGAACTTAAAG
TCAGCAGTGCGTAATATATA