Description :
From Genome Similarity Track
Location :
scaffold_38:64814- 95070
Transcript NameFunction/comments
g12670.t1 hypothetical protein PHYSODRAFT_470590
g12671.t1hypothetical protein
g12672.t1 conserved hypothetical protein
g12673.t1 conserved hypothetical protein
g12674.t1 hypothetical protein PHYSODRAFT_485256
g12675.t1 hypothetical protein PHYSODRAFT_321958
g12676.t1 conserved hypothetical protein
g12677.t1 hypothetical protein PHYSODRAFT_552012

Sequence
30256 bases(100 bases per row)
TACTGTTACCAGCGGTATCAGCGTGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTGTCACGATATTTGCTCCTGGCAGTATCTATGGCGGACGTACT
GGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACTCCATCGCAGAATTTTGCATCGTGAACGCCCAGATAGTCCTT
TTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAAAGAGTATGATCTAGTAGACACAGTTGGAGACGATAAGGTCC
GATAGATGTCCAAGCTTTAATTCAAGACCACAATGGCCAACTTAACCGAAGCCGATCCAGGTTTGTGCTTGAATTATTTGCAAGTAACCAGTTGTGACCA
GGATAGTTCAGAGGCACGAAGTGAAGCTACCAGCTCCACGTTTTCGAGGACCAATGAATATTCACGCGCGACACGAGCTTTGGCGTTGGCATGGACAACT
TTGCAGTCGAGTCCGTGGCCGCGGAGGTGGTAAAGATGAACTCGAGCACGCCCGAGTTTCAGAACAAACAAATTCCACGGGTCGCTCAAGAACACCAAGT
TCATCAGCATTCGCTGAGTTGTCGAAGCGGCCTCATCGCCATCAGCAGCAAGATCATTGTCGTTTTCTCCCCTGGTAGAATCTTGCTTTTGGTCAATGTT
GCGTTGGCTTAACCACGGTGTAGTAGCGGTCAGCATAACGAGCAGAGGCCCCAACAGATCATCATCCCAGCTTACGGAAAGACAACTTGGTTCCCAAAGA
GCTCCCGCGGCACTGGGAACAGCTGACCGAGCGAAAAACAATGGATCCGGGACTGTATCGCCTTTCGACTGTGCTTTCGCCTGAGTGAAGTTTGTTGGTT
TGACCCATCGGCGTCGATGCCAACGCGTGAGCCCCCGTACCGTTAAAATGACGAACACATAGATAATTGCAGCAAGGGCGACGGCCAACATATCGCTGTA
AACGCCTTCGAGGTTCATTTTCCACCCATCTAAAGTCTCAGAGCGCAGCAGCATAAAGGTTGGCACTGGCTCCACCTCATTGGCCTCCAAGATCCTTGCG
TCACGGTCGTCGACAGCTATCCCTCCATGTGCTACAAAAGCCACGGCACCGAGTGCTAAAGCGGGTAATAGATGACCACGCACACCTGAAACGCCATGCG
AAGGAGTCCAGGCACCAGCTGAGGTCTGCAACAGCGCTCGGAACCGTGCCAGCAGCGCCATAAGCCAAATACATCGCATATGGACAGCCAACCAGCGCGT
TAGTGCTGAAAAACTCTCCGTCGCGCTTTCTCCACCGTCATCTTCCAGTTCGTAAAGAATCAAGGCGTCGATAATATGTGCACTCGCGTAGCAGACTACG
GGTAACCAACTGCCATACACCACAACTTGGCTGGGGATAGCAAAGAAGACACGTAGAGCGTGCTTCATTCTTGACGTATCCGTGCCGATCTTCTGACCAA
CATTTTTGTCGACAACGGCAAAACAGGCGACAAGCAGACACACCACTCGCACGACGACGTACAGTTGCCCGATAAAGCGCAGTGTTGATGCCAAAGAGCT
CCATTCGAGGGCGTCAGTGTAGAGGACTTTGCCCTCGACACGCTCATCAAAAACCGCTATCGTCTTACAGACACGTGCGTCAGTGCATTGTCGAATCCGG
TAGAGTGCCACAACATTGTAAATCTTGTGAGCAATCAAAACAGCCCCACCCAATCTTGTCAACGGGTCCGATTCAGCCTCAACTAGCGTGACATCGAGCT
TTTGACCATGTGCTAGTGTTGCTTGTAATGCTGCAGCACGCGATGACACAATCTCCCATAGTGCTTCGCTTTCGGTATCGTCGACGGGTAGAGCAGCAGC
CCACGGTTTCTCGCAAAAGAGCGGCCGATCCAAGTCGTCCACGCACAAGTCGACTCCAGGATTTTTGGTGTCGAGATCGGTGAACGTTGTAACCCAAACG
CTGAGCCAATACTTATGATCCAGCAAGTTGCGTGACAGAAAGCTGGTGCTGCTACTCGCAGCAGTGGAACCAGAACCCGCGCTACTCGTACCGGTCCAGC
GAGCTTTAGCACGAGCTGAGAAGCACACGCGTTGGGGCAGCGAACTTAGTTCGCCTCGTGCCATGATCGCGATGCCTTCTTCTGTTTGAGCCACATTCTT
GTAGCTTGTAGTGCTTGGAGCATTGGCCGCCACCGCCTCGACAAGGGTATCGAGCATGTTGAACACTGTTACTGCAGGCAGGGAATCGCCACAGTCGCTA
CTGTACGACGCGCCCACGGAATGAGCGCTTAGTAGGCACGTCGGCCAGGATGAATCCAGCATTGGGGACCCCTCCAGCAGATCACGAACGGTGCGTAGTC
CGTAGGAGCTTGGAGTGAACTTGTAGAGCGCAGTGGATACCTTTGAGCTGCTGGCCGAGACTCCGTCTGTGGCCACCGTGCCATTTTGAAAGAGCGTTTG
ACTTGGTAGTGCCGTGGGTCCGTACACCGTGAAGACATTTGGCTCGATCTGAACAAACGGAAGCGACGTCACGCTCGATCCCGCACGTGGCACATCGGAA
ACGAGCAGCGCGTACGCGAAGAGAGCCAGGATCACTCGGAGAGCGGTGGATCGAGGCAGTCCCTCGACGAAGGTAGCCGTCTCGCGTGCACCGTCCGGAT
GCATCGCGTGCAGCAGCAGCGACGAGCGTTTGCGCTGCCAATTGTTTTCGGTTGGTACAGCAGAGGCCGACGGCGCTCCGGATGGCTGGGCACCAGGTCC
GGCGGGTGTCTTAGCTCGAGTGTCGCTGTTGAAATCCGGATTCGCCTCGACGTCCTCAGTTTGGTCGTGCGGCGACATGCGCTTCTTGGACTGGTGCGGA
GACTCGAGAGCACTGCCGATGCCCCCATCGCTAGTGGCCATGACGGCGGATCCGAAGCTGCAAGTATTGGGAATGCCGACTGTTGCCCCTACTGCTGGAT
GGTCGGCGGTTTCGACAAAAGATGCCAGCTTCGCTTGTAATGTATGGCCATGTTTCTGCTGCAGGAGTCGGCATGAGGCCTGGCCCTTGATGTGAAGCTA
CTGCTGGAGACGGTTGTACCAAGTCACAATGGACTCGAGCCCCGAAGGGCTTTTCGGTCCGACATGGCTACATCTCGAGACACTGTGTCCACGTATTTAG
TGCAGTAGCGGATACACATGTACTTTGCCACCCACCACTTCCTTGCTGAGTCACCCACTTCCAGCGGAGTCTCCAAGTTGGCGTCTCCGAGCTTTATCGG
TTGCATGGCCTCCATGGTTAATGCCCCATAGTGACCGCATCTCCGCTTCTCGCTTGAAGCTTACGCCACGCCTCCAATAGCCAAGTGCACCATTGCACCA
TGAAAATCCATCGCAGCGTGTGACTTGCAGCGGCCATGTGGGCGCGGTATGGGTTCATTTTCGTCCAATCATGTCCCGAAATCGCGTCCCAGAGCCGGCA
TCTGCCCAGCCACTTACATTCCCGGACTTGCCATCGCTCGACCAACTTGCCGCCCGCCATGAGCATCGACTGGTCACTTGAGTGCTGCAACGACAAGCAG
TTCCTGTCCATCTTCCTCATCATCTGCTACGCCGTCGCCATCTTCAAACTGTGCGGCCATCGATAGGTGCTCCACCGAGCTGTTTCATAGTCTTCTAACC
TCCTTCTCTTTCTCCCAGATGGCGCGTATCAATCCTCCACCCGTTTAAAATCCTGTACGTAGCCATTGCTGCCGACGATTTGAGGGTTTCCTTATAGCTG
ACTGGGTTGTCGTGGCTGCAGAACGGTCTTCCTGCACGAATTGGGGCATGCGACGGCTGCGTGGCTCACTTGCGGCAGCGTACGAGACCCCCGACCTAGT
ATGATATGAAACAATTGACCTGATGCGACTATTGCCGCTTTGCCCATAGGTTAAAGGAATGGAGGTGCACCCGGACGAGGGCGGTGTGACCAAGACTGTC
GGCGGACTGCAGTGGGTCATCCTCCCAGCTGTACGTCGCTGTGGGGAAATTGTGCTTTTGGCAATGTACTGACGTCGTCAATTGGTGGCAGGGGTACCTG
GGATCGGCAGTGTGGGGCATGGCGCTGATGATTGCGAGCGCTGACAAGACTGCATCGGAGGTGGCAGCGGGCGTCCTCGTCTTCTTCCTGCTCATCTTCA
TCTTCTACGCGCACAACGGCTACCTGAGGATCCTAAATTTCTGCTTCATCCTGCTGCTCGCGGGCTTGCTGGCACTCAACATTTGGACGACTTTCGACGC
GCTGCAGTACGTGACGCTTTTCCTGGGCGTCATGAGCTGCCTCTTCTCCGTGTACGACATTTGGGACGACCTCATTTCGCGACGAGTGAACGAGAGCGAC
GCGTCTGTCTTTGCCAAGATGACTCATACGTCGAGTCGCTGCTGGGGGGTTATCTGGGGCATTATCGCGCTCGTCTCGCTCGTCGCTGCCGTTTATTTCA
ATTTGCTGGTTGCACAGGACTCTGGCGAGTCGATTACGAACATCTCCGACGCCTCCACAGGCACGAAGATCGCCCTTGCCTGCGCCGTTATCATCGTGGC
CCTCGCCGTGCTGCACACTGGATTCACGCGGAGATGTATGCTGCGCAAGCGTGAAGGGTTCAGGGGCTACTTCTCCGCTTAGATATTATCGTGGCGATGC
CAGTACTCGAGTGCCTTCATTATCCGGTACTGGGGTGCGTTTTACGCGGTGGAACTTGGGCCAAATGATATTTCTTCGTCTCCGTTGTAGATTTCTTTCC
TGTGTCGTTATCACTCTTTACTGATGGCGCTGGAAACCAGGCCACACTTCTCTACGATATCTACCAATACACTGTACCTACCAACTCACTGCGAGCACGT
TCTAAATGCTTAAGGCGTCATCCTCAAAATCTCTTTGTTCGGGTTTGTCTTGCTGCCTTCTTGCCATCTCTATGGAAGGATGCCGTTGGTCATGCGCTGG
AAATTGTCGTATTGACGAGTGCTATAGTTGTTGTTGCTCTTGCGGATAAGTGATAGCACGTGCGCCACGGTTTCTTGCTTGGATAACGACAGCTTGAAGC
GTGAGCGCAGGCGCAATAAAATATAATCAGCGTCGATGCCCAAGAAGCACGGGTATGGCGACTGACGTGACATAACATCCACGAGGTCACAGATCTCGTC
ACAGTGCTGTTGGCACGCCAGGAAACCCCGCGTGCAGAGCGTAACATACTCCTTGAAGCCTTCGGAGTCTTGGCCACCCATAGTCTCTACCATTTCGGCC
GTCAGTTTGAACGGCGCCGTCTCGATGCTAAGCATTCCACCCGGAGCGATACCAAGCAAGAAACCGTAGTCGATATGGATAATATGGCCTTCGTTGTCCA
GCATGATGTTGCCATTATGCCGATCCTTGATTTGAAGGAAGTAGCACACAATCGAGTATCCTGCCATGGACTGGATGTATTTCCGTTGTGCTTCCTTGAA
TCGATGTGAATCCGGCGGTCCGTAGGACTTTTCAAAGTGATGAAGCAGAGAGACATACCCTTCACGCTTCTTCAGACCATCCAGAGAAATAGCGTTGATG
AGGGTCTCAATCAGCCCCGTGGACGAGCTCGTAGCGATGATGCGGTACCTCTTCACCCACATAGGCAGATTTGCTCCCCTGAAAATCTCGACAAACTTCT
GAATCAACTGCAGAGTAAACACCTCCTGTCGAAGATCGTCATTACTCTTGCCAATCATTGACACGATATCCCACCCAGGTAGGTGCCCGTAAGGTGATGC
GGCACACAGCCTTGTTCGTTTGGAGCTCCACGATTCGCCAAAGGCCGCCTCGAAGTCTCTGCGGCGGGCCTTTTCACGCTCCACGGCCTCTGCAGTCAAA
TCACCCGTAGCCAAGTCCATTTCCAGTGGTGCTGTCGGCGCACCATCGGTTGTCGTTCCACTATCCACGGTAGCGCCCACCGTATTTTCAATTAGTATCG
GAGGCGCCGTTGAAGGTGTAGAACAAATATCGGGAACATCAATAGGCGTCTCAGGAACTGGGGCCCGGCGAACTGCAGCGACTGGTGTTTGATATGGTTC
TGGAGCGATAGGAGGAGGAATTATAGTTTCAGCTTGGATTTCCTCCACATCATCAGCTTCTCCAGCAAAAGCTTCACTGGCTTGGTGACCAATCAGCTGA
CCAATCTCATCGTCCTCGACGTAGTTGACCTCAGAAGATTCCAGCGCACCGTTTCCGTTCATATTCTGCCTTGAGGGAGACCGCGGTGATTCGGGAAGCG
AGGTATCTTGCTGTTGGTCGTCGGTGAACGGGTTGCCACGAATTACCTCGAAGATCAGCAAAATAGGAACGCGAGCTTTCGTCGAGAAAGCGGTGCCTTC
CTTGGTAGGTATCCGCACAATACGTTCGAATGGGTCTGTTGCCTTTACCAACGGCACATACGCCATGGGAGGGAGATGCAGTTTCTCCAAATACGATGGG
AGTTGTTGTTTTCGATCCTGAATGGACGGCACGAAGCGCAGAGCCTCAGCAATGTCAGTGATTTGCTCCACAAAATCACATTCGTCAGCGAAATGTTTTG
CCAACAAGTGCTTATCCGTTTGGCTCATTCGACGCATAGACTCACTGAAGATGCTGGTTGGCTGGTTATCGGTGTCCTCTTCCTCAAGAACCGACAATCG
TTCATCTTGTTCATAGTCGTTATCTGTAGGATGCGAGATCAGCATAGAATCAAGGTCTTCCTTGGGTGTCAACAAATGCTGTTGGAAGCGCGAAAAATCA
CGGAATCGACTATCGACATCAGCATCCGACCCGCTGCGATCGGTGCCATTCCTAGCCAATGGCGGGGACAATGGTGGGTATGGATTCATAGCTGCAGGAG
AGCCATTGGCGAGAGCGCTGCTCTGCGCGAGACGACGGTGGGTCGCAATCTCCTCTGTCAATTTAACGATAACTTGCAGCTGATCATCTGTGGGATTCGG
CAGATTACGCTTGTGCCCCTGGGCTGTCTCCTGCTGCGGATCGCGACTGAGCACGGTTGCACGGTCTACACCGGCAACCTCGCGCTCAATCTCGACCATC
AATCGCACCACACGTGGGTATTTATCCTGCATGTCCTTGGGTTTCCTCGGATCAAAAGAGTCCTCCAGCGCGCCTTGTAGTTGCCAGCGAAGAAGAAGAG
CTAGGTGGATAGATCGCGAGCACACCGACAGGATGAGCTCGTCCAGCCAGAAAATCTTTTCAAAGTCAAAGTTCGGAATCGATAGGTACGCGTGCACGAT
CTGCGGCCAGTAGAATTCCACTTGGTTGATACGCGTGTACGAAAAATGCAACAGCTTCTCCACGATAGGCTTAAACAACAGAGGGTCACTGTCCAAATAG
CGATGCAGCAGAATCACAGCACGATAGACGCTAAAGCTGCGCACACGGAACTCGCGGTGTAGACCTAAGATTTTCAGGTCTAGAGGTATCTCTGGATGGT
CCATGGTGTGATCATAAAAGCGTCGATCCTTCAGCAAGATCTCTTCACATTCTTCAGCAGTAATTACCTTTGCTTTGAGCAAGTCAATAGCAATCTTTGC
AGACTCAGTCTGCAGCGGACGCTTCGGCATGATGAGCTCAATCGGAGCCTCTGGATTCAACGGACGCGGATACAAGCAAATACCAGCCTTCAGTCGCTCC
ATCATCGCACGCAAATAGTTAATGTAATTCTGTGCCTCATAGCAACGGTCACACACTCGCTTGGCGTAGTAGTGCGACCTCTGCGGGAGCGGCACTTTGT
GCGTCGTAAACTTGTCACAAAACAGTCCATCACAACTGTTACATTTGTACAGCAACGCAGCAGCAGTCGGGGCCAATTGCCCCGCAGAAGCAGCCTCTGC
TACCAACTGCGTGCAGTCCGGACACTTGCACGTCACATCTGTCTCACTCGATGGCACCGTCACGGTGCTCACGGGCGAGATCGACACATCCAGCGTCGCG
TGCTGAAAAAAAGCTGCTGTAAGGCGAGGCACCGTGGTCTCCACTGACGTCTGGATGGCACGGATCCATTTCTCTTTGTCCATGGCCGTGTCCGCGTAGG
CGTAGAAGACCTTATTCTGCGCCGTGGCAAACAGGAAGCCGTGCTGGTAGATGTGCATGTTGCCTTTGCCGTCCCACTCCTGCACCCCCAAAACGTCCGC
TTCGCCCTTGAGCCGCAGCATGTGATACGCGTCCTCCTGCGTGCTGCTCGCATCACAAACCCAAAGCAATTAGCACCAGGAGTCAGACTAGTACCAGAAT
ACAAATCATATACTGTACCTATAGTATTGGAAGGAAGTGCCCACGAGGAAGCAGTAGCGCCGCAGCATGGGCGGGGGTGACGACGGACTCGTGCGGAAGG
TCAGGTAGCCCTCACAGCTGGCGCGCGGGGCCTTCATGGAGCTCCACGAGATCAGACGCGGTCTAATACGACGGCGGCGTCTCGTGGTGCTGCTGAGTGT
TGATGTGCGCTCGCAACGGGGCGCGCAATGCCGATCTGCGCGTGGACTTGGGCGACGGCTGATTACTCACCTCCGACGCACCCAATACACACGATCAACG
GATCACCGGACAGAGCAGACGGCGGGGGGCACGAAGAGTCTGAAGCGGACGGCCACGCGACGCTAGGGACGCGTATGGGGAGAGGGAGCGCGGGCCGAGA
GCGCGCGAGCCTTCTCTCTTCAAGTGGGCGTTGCGGTGTTGCGTGGGAGGGGGGAAGAGCGACCCGCGTTATAGTGGCGTGTCACAATCATGCGGGAATG
GTACCATGAGTATGGTACACTCGGTTTTGCTGGTTGCGAGCCCACCAGCAATTCGTGCATCAACGCATTCGCGACTGTAGTAGACCGATGGCTCGCGGGA
AAAAGACGTTGGCGGCACCGCTGAAGGCGTCCACGCCCAGCGTCAATGGCGGCAGCAAAAGCAGCAAAAAGACGGCCGGCGTGGCGCAGAAGAAGCAGAG
CAAGCAGGTGAAGCCTTCCCCAAAGAGCCCCAAGAAGACGGTGAAGGTGGCGGTGAAGGCGGATGAAGCAAGCGAGGGAGAGGAAGAAGACGAAGAGGCC
AGCGATACTGAGAACAGCGACGACGCTGATGACGAGGAGGATGACGAGTTCGAGGACCAGGGATCGTCGTCGGACGATGACAGCGGCGACGAGGAAGAGG
ACGACGCCGACCTCACGGAGCTGGAAAAGAAGACGCGGCGCTTCACTGTGGACCGCGAAAACGAAGTGCAGAAGATGCGTGAGGACGGGTCGCTCCAATT
GGCATCGCAGTTGCACGTGGACGACCTGTCGTCTGATGACGAGGTTGGCTGCCAATGCTTGATGCATGTGTTGCGACGTGTGAACTTATCCTTTGGTTGT
GCTTTTGCAATGATAGGAAAATGTCAACACTATTGGTAACGTGCCACTTCGGTGGTACGAGGATTACGACCACATTGGTTACAATGTGGACGGCAAGAAG
ATCATGAAGTCGAACAATGGCGACGGCATTGACAACGCGATTGCCGCGAAGGATGACCCGAACTACGAGTAAGTGACATCGAAGCCGTAGGATTCCTCTT
ACCTGCAGACGTCTGACTGTGTGTTTGTCCTTCTTGACAGCCGCACCGTGTACGACGCTTACAACGACCGTAAGATTGTCATTTCGGAACGTGACATGGA
AATCATTCGTCGTATGCAGGCGGGTGCATTTGCACACCCGGAGTTCGAGGCTTACCCGGACTATGTGGACATTTACTCGTCGAACAAGATGATCCACTCC
ATGGGCAACGAAGTTGAACCCAAGAGCCGTTTCTTGCCTTCAAAGTGGGAGCGCATGAAGGTCATGAAGATCATGAAGGGCATCAAGGAAGGTCGCATCA
AAATCGATGAGGAGCCAGAGAAGAAGCCCGATGTATACCAGATGTGGTTCGATGATGACCAGGCGCAGACTCGGAAGGGTCCTGCTCACGTACAGGCTCC
GAAAATGCCGCTGCCCGGACACATTGAGTCGTACAATCCTCCTGATGAGTATCTGTTTACTAAGGAGGAGCGTCGAGCTTGGGAGGAGGCCGAGCCGGAG
GACCGCGAAACTAACTTCATGCCGAAGAAGTTCAAGTCGCTGCGTGAAGTGTGCGGTTACAATGGCTTCGTGCGTGAGCGCTTTGAGCGTTGTCTGGACC
TGTACTTGGCGCCGCGTGTGAACAAGCGTAAGCTTAACATCGACCCCGAGTCGCTTGTGCCGGAACTGCCGAAGCCTCAGGACTTGCGTCCTTTCCCAAA
CACACTGGCGCTTGTTTTCAATGGCCACACTGGTCGTATCCGATCGCTGGCTGTGGACCCGTACGGCCAGTACGTGGCCTCGGGCTCGGACGATTTCACT
GTGCGCATCTGGGAGATCGAGACTGCGCGTTGCCTGCAGGTGTACAACGTTGGTGCCGTGGTGCACAAGCTGTCATGGAACCCGAACAAAGACCACCAGT
TGCTGGCTGTCGCGGCTGCTAAGAAGGTCTTCATTATCGCTACCGGAACGGGTAGCGCGGATCAGACGGAGCTTACCAATGCCCTCGTGGGCGACGCCGA
CGAAAGCATTCAAACGTCCTCCGAGAAGGATGACAAGACAGATAACGCCGATGGCGACGTCCAAGTCGTTGATGAGGATGAGGCCACCGTAGAGGCTGAC
GCGCTTAAGAAGAAGGTGCCTGTGACTTGGCGATTCTACAGTGGCACGAAGGACAAGCACAAGTCAAAGAAGGCTGCAGAGCGACCGTGGCTTGAGCGCC
GCGTGGGTACTGGTATTCGTGTGGTGCTGCACCACACGAGCGACGTGAAGGACGTGGCCTGGCACCACAAGGGTGACTACCTCTCGACGGTTGCCCCTGG
CGCCGGCTCCGGAGCGGTGCTAATCCACCAGCTCTCAAAGCGCAAGACTCAGAACCCGTTCCAGAAGAGCGTGGGCCAGGTGCAGTGCGTGCTGTTCCAC
CCGTCCAAGCCGTTCTTCTTCCACGCCACCCAGCGCCATGTGCGCGTGTACAACCTTGTGAAGCAGTCGATCGTGAAGAAGCTATCCTCCGGCGTCAAGT
GGATCTCGAGTATGGCCGTGCACCCGAACGGAGACCACCTGCTTGTGGGTAGTTACGACCGGCGGTTGTGCTGGTTCGACCTGGACCTGTCCTCGAGGCC
GTTCAAGACGCTCAAGTACCACGAGAAGGCTGTGCGCGACGTGTCGTTCCACGGCAAGTACCCGCTCATGGCTTCTGCCTCGGATGACGGCACCATTCAC
ATCTTCCACGCCATGGTCTATTCGTACGTATTGCTTGGCTCTTGCATTTTCACAAGTGGCTTCACTGAGGCGAGCCAGAAGCGATTAATTGAGGTGCCTA
ACTGCTAACTCATGTCGTGGCGTGATCTCTGCAGGGACCTGATGAAGAACCCGCTGATCGTGCCGCTCAAGATCCTGCGTGGCCACGAGGTCTCCGGCGG
CCTTGGCGTCATGGCGCTGGCCTTCCACCCCGTCCTGGTACGTTCCTTCTGCCGCTCAAGCAACGTCACGCCATTACTACCGATCTAACTCTTGTTGCAA
TTTGTGTTGATTCGCTCAGCCGTGGGTGGTGACAGGCGGCGCGGACGGTTCCATCCGCCTCTTCCAGAACATTCACTAACTCGCCCGTTGCAGCGACCGA
TGAATCCGAGCAACCGTCCACAAGACGTCGGTAGCGGTGCGCTTCTGCAGCTTTCGAAGGAGGAAATGCGCGCTGCCGTCTCGGCGTGGGCAGCTAGCAA
CTGTGACGATTTCAACTAATAGACAATGTGCCTTTGAAACCTCAATGCTCGATGCCATAGAGACGACGATCGTTTGTGCCTCCGTTTTGAGCTGCCGGTA
AGCGGTAAGGCTCAGGCGAACAGCAAATTGCGCCAGGCTCATGATGACGGCACACCTCGCCTTTCCTAAGCTGAAAGCCAGTGCACTGACGCCGCTGCAA
TGCTACAGCAGCATGGACACTTTGGTAGCATGACATGTGAAGTCCTTAATTTATTTATCATGTAAAGGAAGAGGAAGAGTACGCGACAGTCTCAGTCAAG
CTAAGCTACTCGGTCCAAGCGGATGGAACAGTCCTCCCTCCATCTGCACGCATCAGAATACACCACCACGGGGCTCTACTCGCCGGGAGAAAGAGACCAC
AATACTTGATCATCGTCGTCCGCCCGCTTGTCCCTTTTCTCGGCGAGGCTGCACGCAACTTCCAGAGAGCCACGCGTCCGTCCTAGTTCTTCTTGCCCAT
GCCCGGGATTCGGAACCGTGAGCGCTTAGGAGCTGCTGCAGGCATCGGCGGCGGCATCTGGCCGTATCGCACGGGGTACTGGTACTGGCCGCCTAGGGTC
GTGGCCGGGTATTGCTGCTGCTGTTGGGGCTGACCATACTGCTGCTGTTGTCCATACTGCTGCTGCTGGGGCTGACCATACTGCTGCTGCTGGCCGTACT
GCTGCTGAGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCTGTGGCTGGTTGTTGCCGTAGCCGTATGTCGGTTG
TTGTTGTTGCTGCTGCTGTTGACCGTACGTCGAGTTCTGCGGCGGGTACGTACCCGTGGCCATAACCGGCGGGTAGCCGGCGTTGTTCATGGGGTTGGGG
CGGTTCTCCTCGTCCGAGTTGCGCTGGTTGGCGTTGGAACCCCCGCGCTTGTTGTTCATGGCGTAGAGCGAGCCCTCTGTGGGCTCGCCGTCGCCGTCCA
GCAGGCTGGCGCCGTCCACTTTGCCCTTGCGGTCCAGCACCGTGTCGCCTGAGAGCACCGCGCGGTCCGACTTCTTCTTGCGCAGGAATCCCACCATGGT
GAGAATAAGGAGGGCAGGTGGACGGTTGCGTGTGTAGATAGCAGAGCGAGGGGGCCGCTGCTGCTGAGTACCGAGAGCTTCCTTGCGGGGACCGGGACGA
TTCAAGTATGGCAACGCGCGTGCGTTTGGCTTCGAGTGACCAGCCGGAAACTGCGCCCCCCTGCCGCTCCTCTTCTATGCTGAAGAGATTTGTCGCAATT
TTGTGGAAATGCGGCACTGGGCGTTTGTATGGAATTTCACGTCAGCGCGAAAAGGCGCCAGCCCAGAGGCCCACTGCGGCTCACCTAGTCTCGAACTCCA
CAGCCAAATCCACGTGGACGCACACGAGCGAGAAAGCTTGCTGACAGATGGCCACCAGACTGGGAGTGACTATGCCGGCCTGTCGTACGGTTGTGTCGCT
CTACAACGAGGGCTAACAAGCCGAGTCTGTGCGTAAACCGCAGCGGCAGACTGCAACTTGTCGTGCAATGGGTTTACGACTCGCAGCAGGGCATGTACCT
GTCCGTCGCTGGGAGAGCTCCGAATTACTGCTACGTGCACTGCAGCTTTCCACGAAAGCAGACCATCTGACAACACACCGTTGCCAGCTCGCAAGCCGAA
AACAGCGGTTTAAGACGAGGGTTTCAGCTGCGGACAGCGGAGACCCACGACGACGACGAGATGGCGAAGCCAAGCCAAGATATTGCATCCGAGGGTTCGT
TCTGTCGGCTGTCGCCGCGCTTAGCTCAACTTGCCTGGGCGTAGCACCGCGTCAACACGGTTGCGTCCGTTTCCACCGCTGCGCTAGTGCGAAATTCAAG
TTTCAATTTTTAAGTTGCAGTGTCATCGCAGTGGTATCTTACGTATCCAACGCGACTTTTTGAGGCTGAGACATGTGCAACAAAATGGCGAGTAATTGCA
GCGAGACCAAGCACCACAGCCTCGCTGGCAGCAAGTTGCTGCTCGCTACGCTCGGCCTAGTCGTCGTCGCCTGCTATGACCAAAGAGCTTCACGTCCCGG
GACGTCTGTGGTTCACGACGCTCAGCCCAGTCGATGATGCTTGACCGATCACATCCTTCAGACGCGGACTCGCTGTCTGTCTGTACGTCACCGCAATGAC
CGCCCGAGGACAACTTCAACCACACAGCCTCACAACGACGGCAGCCAGCCCGTGCAGCCACTTTTCGATCGCCCGCATTGAGTCGAGGCTCGACATCCCA
GAAGAGCTCTCTCGCCGAGTGCGTGGCCTGAATGAGTCTCTACACCAGCACGTAACCAGACCAGCCAGCACCAACGTTGGCTTCGTACTACCTCCACGTG
TCCAACGTGCGACCGAGCGTTGCATCGAGCAGCTGTGCGGCCTGGGCAACGGGCTGCACAATGGCCTGCATTGACGGTGTGCCTGGACTTGCACGGCAAG
ATGCAGTGAATCTGGCCCTGCGGCATTTCTATCAACAGAAGGAACAGCAAAGTCCGCGAGGGTTGGACGTAAGTCAACAACCAAGTTCTTCACTCATTAC
CGGTCCTGTAACGAGTTGATATCAACACACTTGGTAAGAGCATTAGTGTATTAGCACGCTACACGACCATCTCAGTCAGGTTGGCGTGGTGACTGTTTGT
GAGGGTGTCTCTGTGTAATGGTGGTTCCAGTGGCGACCGGGAATCTGTACTGCTATGCTGCGGGTTAGTGTCTTCACCACGTCACGTGTTTGTCGAGGAA
ATCCCGTGTCATCTCCTCGTTCTGCGCTATGTTCTCCATGTAGGTATCATAGGACATGTGCCACGGATCCGGCACGTCTCGCGTGAAGACGGCGAGCACG
CTATCTCGCTCTGTGATCTTCGGGAACTTCTCCGTGACCTTGAAGGCCATCCCGCTCGCCACGCACACCACGTAGTCGGCGTTCATGCACATTTCCTCTG
TCAGCAGCCGCGAGCGGTGAGCCGACAGGTCCAACTCGTACTTCTTCATCACGTCCACCGCGAACTTGGACGCGGGCGAGCCCTCGCGGTCGAACACGTC
CGTTAAACTGCACGGCGAAAACAACCATCAGCAATTTCGGCAGCCTCCGCAAGTTCCTAACAGCGAGGTTCGCACGTACGCTGCCGACCGGATGACAATG
CCCTTCTCTTCCTGCTGCTCGCGCGACATGTTGAGCTTGCGCCGGAAGTACTCGACAGCGAAGAGCTCCGACACTGGCGAGCGACACGTGTTGCTTGTGC
ACACGAACACGATGTTCATGGTCTCTTGGCGTGTGCGGTGCGGACACAATTCTGATGTGGAGAGCTTGCTGCGACCCGCCGCCCAATGGTTACAAAGACT
CCACAGCCAGCAGTAAACGAACGGGGCTGGAGGTGACAATTTCGTTCCCGCTCGCCTTGTTGGCGTCGCCGACTTCAAGCGCGATGGCCGTCGCATGCGT
GCGGAGTGGATTTGCAGCAGATTTCCAGGCGACCGCCTGAAAGCTTTCGACCGGCATGAGCGACAAGCAATATATCTACATGCACGAGCAAATGCACACG
AATATGCACTGCTCGCTCATGCACAATTTGGTGGCGAATTTGCCACACGGGAACTATATTTGAAATGCCACGAATGTGCTTCCAACGTATCCAATGCAAC
CGCAGCTAGTTTACTGGAAGCGCTGAACGACCTTCGCGTACGGGAATGGTCCCAAAAACTCGCTGTGGTTTTGCTTCTTGGTAGACGCCTTGAGCAACGA
ATAGTCGAGTTCCGTGTGCAAGTCTTTGTTGGCAGCGTACGACTGTGGATCCCACTGGATGTCGAAGCTGTTGACGAAGAAGCCCTGGAATTGTGCGATC
CATTGACGCAACGCCATGTACGGGATGAAGTAGAAGCCGCACCGGTCAGTGTCGTTCTCCTTCACCTCCTCATCAACGGGTGCCAGAGTAAGCGCGATGT
AGACCTCTAGCATTGGAGGCAGGCACATCTCGCGTGCCACATGCTGCTCTGCCGAGTACTCCCACAGGCACATGACAGTCATGCGGTCGCCCCAGTCCGT
CGTGTTGCGAACGAAGTAGGTGAAGTCGCTATCCGTACGACATAGCTCTGAGTCCTTGCACTTCAGATGTAGTGGCTGAATATTGACGTCTGCGAACACT
TTTGTCTCGTCCGAGAGGCAGTCTTCGATACCTTCATTATACTCCAGGGTGTTGTTCGCTTGCTGCTTGAACGAAATGCCTTCATTGCCGCACTGGTACC
AGTTGAACGGGCTAGATAAATGTACCAAACAGAAACAGTTAGTTAGTCATTTTACAGAGTAACCATGCTTCGCAACGTACTTGTAGCTGTTGGGGCAAAC
CGAACGCTCTTCCCAATCCGAAACCTCCTGCATCCAGTATGCGAGAGAGTGACTGCCTTGATAGGGCCCATCCGCCCAGGAGTTCTTCACGATAAGTCCG
CCAGTGAAGCCTTCGCGAGTAAGGAAGGCGTCATTGTAGCCTACAAGAAGCTGCCAACACAATTGCAAAAAAACCGGGTAAATGACGTAGTCGTCACACA
AATCTGACAAATAACTTACCATGGCGTGACCACCCTCGATTGACATGCCACGGTGGCTAAAGAATTCGCCTTCCATGTTGCGGTTTCGACCTCCCTTCAA
AGGAATGCAGCACGTCGTAGTAGCCATATCTCCTGGACACAGCGTACACGTTTCCGGCTGGCAGTGGCGATCATTCGAGAACGCGCCAATGCACGGGTAA
TAGTGAGTGACCATGGCGATCGGAGTGGAGAGAGGCATTGCTTGATTTTTGCGGACAAGGTGCTCCCTCACGGACATGTCTTCATACTTGGTCGTCATGC
TCTACAATATCGAAATCGAAACAAAACACAGTGTTAGCCAACCTAATTTCCGATGTGATTCTTGACCGAGTCTCTTCGCTTACAGAAAGCTCGAACTTGA
GCGGATTCCCAGCCGTTTGGGCGGCCTGGAGACCTGGACAAAGCATGTCGTTGCCGTCTTCGGCGTAGTATTCGCAGACAGATTGCGGGAATACAGACTC
TTTGAGACCATTTTGTAGGTAATAAAGTTCCGGTACCTCTCCCCCCTCTGTCGAGTTCATCCACATCTGTATATAGCAACGTCAGCATTTGACAATAGTT
CCAAACAATAGAATATGGCTGACCTCGTCACCCGCCACTCGGCAATCCTTTTGCTGCTGTGAGTCTGCATCACCGGTGCAAAGCTGGAGGATCTCCACGC
CGTACGCCTGCAAATAACCACATCGATAATAAACACCGATGTTCTGCAACAACTTCACTCAAGGATATTAGTCCAACGTACCTGCTCAGAAAATGCAACA
TACTCATTAGGTTTGAGCCAGCCTTTGCGGACACCGTGTGCGCGATACGACTGCTCTAGGAACCCGATCGTCGCAAAGTCCCAGCACGTGCCACGATAAG
CCTGATCCTGGCGCGGAGTCACGAAGTCCACCGCGAACTTGGATGGCAGCAACGCCATCGGGATCAAACCATTTTTGGAGACGAAGCTCATGGCCACCGG
GTCGAAGTCCTCATGAGCAGCATTCGGCGCATCTTGGCGGGCTTCGCTGGCAGTCTCCCTGCAACAGCATTAGGTCAGTAATGATAACAGCCAAACGTTA
ACAACTCTTCAGATCTTTGCAAGGCACATACCGGTACATGCTGCTGCCAGCCTGAGTTTCCAGACGCGAAATCGTGTTGTTCATTGAGATACATAGGAAC
AGGAGCACGAAAAGCGCGACGCCGTTCACCGCATAGAAGACCGTCCGCAAAGGAAGGCGGGGCAGTGCACCGCGCTTATCAGCAACAGTGAGCTGTTGCG
AGTGGACGGGCAATTCATCTCTGTCGTTGTTAGCTGGGTACAAGCACCATAACGCATTCGCAGACATCGTTAGCGTGCGATAAACAAACTCGCCTCTGGG
CTCTAATCGTACCTCTCCCGGAGCCGTAGCGTAGCAGAGGACTGCGGTCTCTAGCGGAGACCGACCTCACCATTCGTCGTGCGGTGTAGGAGACGCGTTG
AAGAATGACGTCTAGCAGCCGATCGGATTTCTGATCGGCAAGTACATCCGAAATATGCTTACCGTGTGCAAACGGACCAGCGAAGGACGCCATTTCTATC
CAATCATATTCCATATTTTTCAAATTAGAAACGTTTGATTGGTTGTTTATGAGGTGTCCGTAAATGGCGAACGTCCGTTTATACACAAGGTTCGCGGTAT
TTGTATCAAAAATGACTTCACTTCACTAGGATGACAGGAAGGAGAGCTGTCTGCAAAACGAGACCTGTAGCTCCAAGTTGACCGTCGTGACTGTGAGAAT
GCTATACCTATAGATATTAACATAGTTTTTCCTTCAAAACTGTCATCGCAGACTACTGTGCATCTACTCTTTGCAGCCATCGCCACCGGCGATCACGAGA
CACGCGGTAGAATCGAAAATGCTCATGAGGTTGGTCATGACGGACCAAATGAGCGAGAGCGACAGATACGCCACCGTGACAAACCCCATGAAGTAGCTAG
AGCCTCCCAGACGCTTCATCATTTGGGTTTGTTCCTTCTGTCGGGGAAGCATCACCAGGAACGCGAGCGAGAACAAGTTGGCCGCCCACATGATAAGTAC
CGTAATGGTAACGTCGTGCCTTACTCCTTGGGAGTCGTTCTGGATCCGCTCCGTTGTCAGGTCGAATTGACCATTGACATTGCGGGTGATCGCAGTTGCA
AAAGGCGTCGAGAGGTTGTAGACCGTCGTGAGCAGACCATACATGGCACCTTCGTGCCCTTCCGTGGACAGCTCGACGATGATGAAGGAGCCCACGATGA
AGATGATACCTTGTGGAATTTGCTCAAGAATGGGAATTCCCATCCAGATCCACGGCGAACGGACGACATCCCAGATTGTCAGGAGCTTGCCCACAGCATC
CAGGCTCACGTTGCAAATCATAGTCACGACCGCCGTACGCCGCCAGTCCCAGTCGCGACCGTAGTTGCCGGCAAACCAGACTGCGATGGCAAACACGCCC
GTGTTGATGAAGCCGGCAATTTTATCTTCGAGCGGCGAAACGTTAGCCCAGGTGGTCTGGATCGGATAACCCGATACGTACGTGAATGACGAGAAAATAC
CCGAGAAGAACTGGTAGGCAATGTACTGGTACACGGCCCGTGTCTGTACAACGTCCCAGAGTTCGCACATGTAGTGCTTGAAGCTCTTGCTATCACCCGG
GCGCTTCTCTTCGTAAATAAACATCCACGTGATCGGCACAATCGGCACAAGAGCGACTGCCACGATCAACATCATGATTGGGAACGTGAGCGAGAAGTTA
AAATCGCCACCGTAGTCCTCGCCGTTGAAGCAAAATGCTACCAGAATGAGAGCGAGGTTGTTGAACACAAAGCGTGTGGTGTAGATCACAGTTTGGGTTC
TTCCTCGAATTTCGAGCGGCTCGCGCTGCGCCAACTCCACCACAATGCCGTCGGCGCACACATCGGCCATCAGATACCCGAACGCGCAGCCCATCATTGG
TATAACGTAGACGCTGCCATCGTCGGCTGCGCCGTAGTTGAGCGTGGCAATGATCTCGGGCGTGTAGTCCTCGGGCTTTATGTCTCGGTACGCTGGGTCG
GTGAAGTACGGCTCGCCCTGGGGTGTGAGCACCATGACCAAAAGCATGGCTAGAGTGATGATCCAGCCGATGACCATGTACGGTCTACGGCGATAGCCAT
GGATCGGGAAGCAGTCAGACACGATGCCGTAGAAGACCTTGAAACTCCAGGGCAGCTGCACAAGCACAGAGGCTGTAGTGGTTTGGGAACCGGGGAGGTT
GAGGTAGTTCTGCAGGAAGGGGTAGATGACGTTGGGCAGCACTCCGTCAATTAATCCAACGGCCGCGTACTGCGCGACAAGGCCGATATACTGCCTCGAA
AAAAGTTTTGGTGCGCCACCGCTCCGGAGCGCGCCGCCTTCGATGTAGTCGTCGTACACGTAGCGCATTTTCCCGTAATGATGCGCGGGTTCCAGCGGCG
ACATGCTGCATTGCGAGTCTCCCAGCATCGCGGCCGCGTCAGGGTTGTACAGCTCAATCTGTTCCGGTAGTGGCATTTCGGTCTCCGTAGGCCTGAAATC
AGACAGGCTCATGTGCTGAAGGCTGCGAATCGAAAACTACTGAGCGAGGGGATCTGCTTGCAGGGCAGATAGCATGGATAATCGCAAGTGGTGGACTCAC
CTCCAGGCAGATGCAGAGGTCGGGCCGACTTTTCCGCAGGATGTGCAGTGTTAGTGGTTCACCTCGCCATATTGGCCGCCATACTGGTTTGGCATCATCG
AAACTTTCTCATGAACAGAGGACAAAACAGAGGGCACCGAACACACGCAAGAAATGCAAATTCGGTAGGCGACACTATCGATTGCCGCTGTTGTAACGGC
GTTATTGCATGGACAGTAAGGCTTATTTAGCTACACCTACGCTGCGAAAGAAGGTTCGAGCGGACGAGCAGTGAGATTCCGAGTCGGAGTGCACATGGTA
ATTCGGCAAGGGCGTACGTATCCTAGACTCATGCCTGGTTGTAATTTGCTGGTTTGCTGGCTTGATGTAGTACGGTACCGGTGCTGGTATTCATACAGCA
AACCACCAAACGACAACACCGGTGCAGCAAACCATTTGGTCAATCTGTCAACTGAGCTGCTCTCTGCAACTGGAGAGAGCACCTTCAGCTGGCAGGGGGT
GCTGACCGTGACCGACCATAGGGTCCTCGCTAAGCACTACTGAAGTACTTGCACATGCATCATACATGATCTACAGTACACGTAGGGGGTTGCACACATC
TTGAGCTACCATACCTGGCCTACGGGCTGGAGAAGTCCTGAGGACGACCACTCCAACGGGTGGTCCCATTCCGCCCCACACGGTACTTCAGCCATGGACC
GGTACAAGCTGGCAAGAAGTCATCGACGACTCGCGTACGAGTTGTTGAGGAAGGCCGCGCACAGTACTCGGTGCGAAGAAAAAAGTTTACCGTTCATGCG
GTTGTAGACCACCCAGCAGACGCAGGAGCACATGGCACGCATGGTAAAACGTGAAGCAGGCTTTTCGATGCCATGACTTGTTGTCGACTGTATTCAACAG
AGACCTGGCATTGAGAATGGCATCGGACGACGCGAACTGGCTTGGCCGGCTCGAGGCAAACGCCAGAGCTTCGTTTCTTGAGCGGTCGGGCTACGGGATA
CCTTCACGATTTGAAAAGCCCGCCAATGTTGCACTGAACTGCTGGATGTACCAAACAGAGAGCCCGTCCGAGTCAAAGTCTCTGCTCGAGACTGTGAGAG
AGGAACTCTGCCAAGGCAGCTGGCAGCCGTCGTCAGTCTCGAGGCTTCCTGCTCGATTTGTAGTTTCCCTGCGCGTTCAAGGTGGTACCCACCAAAGAAG
GACGAAAACTGGTGGAGGTGTCGTGCCGCGAAGCGAAAACCAGGGCTTGCTCGTTTCCTGTGAGCTTAGATATTGGACGAGAGGCTATCCAGGCCCCGCG
TTGGACTGCGAGGCGTGTGTACACTGTAAAAATCCGATCTTACCGCATTAGTCAAATTGCGTGACGAGAGGCACTCTACGACTGGTCTTGGTGGGTCTTG
CGGGTCAACGGACAGGTACCACCGTCATGAAGGCATCGCGGACTGACACGGTGACATCGCAGCAGGCACCAATCGAGCTGTACAACGAGGACTCGTGCTC
GTGGATGATCACCGATTCTCCGGACGATGGTTCGCCGTTCCCGATGACGTTCGAGGGCCAAAAGATCCGCTACATCTACGACGACTACATCGAAGGCGGC
GCGCTCCGGAGCGGAGACGCTCCGAATCTGTTCTCGAAGAAGTACATCGGCCTTGTCGCACAGTACGCCGGCGTCGGATTTATTGACGGAGTGCTGCCCA
ACGTCATCTACCCCTTCCTGCAGAACTACCTCAACCTCCCCGGCTCCCAAACTACCACAGCGTTCGTCCTCGTACAGATGCCCTGGAGTTTCAAGGTCTT
CTACGGCATCGTGTCTGACTGCTTCCCGATTCGTGGTTACCGTCGTCGACCCTACATTCTCGGCGGTTGGGTCTTCGCGTTGACCATGCTTGTGATACTG
GCGCTCACACCTCAGGGTGAGCCGTACTTCACAGACCCAGCGTACCGAGACGTAAAGCCCGAGGACTACACGCCCGAGATCATCGCCACGATCAACTACG
ACGCAACCAACGACGGCAGTGTCTACGTTATCCCAATGATGGGCTGCGCGTTCGGGTACTTGCTATCGGACGTGTGCGCCGATGGCATTGTGGTGGAGTT
GGCACAGCGAGAACCTCTTCAAGTGCGAGGCAAGACGCAGACGGTGATCTACACGACGCGGACAGTGTTCAACATGTTGGCATATATCCTTTTGGGCTTT
TGCTTCAATGGTGCGGAATACGGCGGAGACTTTGACTTCTCACTGTCGTTCCCGATGCTGATGTTGATCGTGCTGATTGTGCTTTCGCCGATTGTGCCAG
TCACCTGGTTCTTCCTTCATGAGGAGAAGAACGCTTTCGGGGCTATGAACTTCAGTCACTACATGCACACCCTTTGGGATGTCATCAAGACACGAGCCGT
GTACCAGTACATCGCTTACCAGTTCTTCTCGGGCATTTTTGCTTCGTTTACTTACCTTTCCAAGAACCCGATCCAGAGGAACTGGGCGAACGTCTCGCCG
ATCGCCGAAAAAGTTGGAGGGCTGTTGTCAACGAGCGTGTACGCCACGTCGATTTGGTTCGCTGGCAACTACGGACGCAACTGGGACTGGCGACGAACGG
CAGCGGTGACCATGATCACGTACGTGTCGCTGGATGCCTTTTGCAAGCTGCTGACGATCTGGAATGTCATCCGCTCGCCGTTTTTCTGGCTTGGTATCCC
CATTCTGGAGCAGATTCCGCTGGGTGTGATTTTTATTGTGAGCTCCTTCATCATCGTGGAGCTTGCTACTGAGGGACACGAAGGCGCCATGTACGGCCTC
CTCACGACGGTCTATAACCTCGCCATCCCGTTCGCCACCGCTATTACGCGCAACGTGGATAGTCTGTTTGACATTACCACGGAGCGAATCCAGAACGACA
GCAACGAAATCCGAACTGACATGGCCATGACGGTGGTCATCATGTGGGCAGCCAACTTGTGTTCGCTCGGTTTTCTGGTGATGCTGCCCCGCCAAAAGGA
GCAGACACGGGCCATGAAGCAACTGGGCGGCTCGAGTTACTTCATGGGCGTCGTCACGGTGTCGTATTTGATGTTCGCGTTGCTGTGGACGTGTTCGACG
AGTCTGCTGAGCATCTTCGATTCCACTGCGTGTCTTGTCATCGCTGGTGGCAACGGTTGCAACAAGCCAAAGAGTCCGTAAAGAAGTCAAATAAGTCTAT
CTAAAATGAAAACTGCAGCGCTAACCGCTGCCAATTGAGTCTCTTCACCCTCTCCACTCGAACATCTCTCATCTAGCACAAAAGCACAGCATACTGTAGC
AGTAGCGCTCATTCTCCAAGAAAGTCTACACCATCTCCAACACAGCCAACTCGACAAATGCCACGTCCTCTTCACTGAAAAAGCGACCAGTCCTTGACCG
CGAAGGACTGCAGCGCCTGCTTAAATATGGCGGCGGCCACCTCCGAGTTGTCCTCGAACTGAAAGGCGTCGCGGCTGCTGCTGGCCGGGTTGATGCGCAT
GGGTGCCGACATCGACAGCACCACGTCCGTGGTCACGCCAGGCAGCCGCACGTTGCCCAGGTACACGCGCACCACGTTCTTGGCGTGGTCGCCCTCCTTG
AACTTGGCCACGCGCTGGTCGCCCACGATGAGCTGCGTGGTATGCGGCGCATCGACGGCGGGCGCGTTCCGAGCGTCGGCCGCCGCCTCCAGCAGTACCG
TCACCTCGTCGGGGCCGCAGCCGTTGGACTGCGCCAGCTCGTTGAAGAAATAGCGCGCGCTGCGTGCGTCCGAGACGCTCTCCTCGTACTGCAGTAGCTC
CACAATGACGCACTGGTCCGTGGCCGCGTTGGCGAAGACCTCCTGGTTGTCTGGAACCTGCCGGAACGAGCTCACGTCCGCGAAGCCCTCGGGGATCTCG
CAGATCAGCGCGCCGCCGAACAACGGACGCAGCATCTTGACTTGGGTTGACACTTGACTGAGGGGTTGATGTGGAAGTGAGCTCTTGGGTTGACACTTGC
CTGAGGAAAGTGACTATTGGTGTACCGTACACATATTTGGTATACACCAGTGGCCTGCGGCATCCAGCTATACTGTGTATAGGTGTGTCCGATTAAGTAT
CCACGATTCGGATGGGTCGCGGCCATTAGATCGGAAATCAACCAGCAGCAGCAGCATGAAGATCGAGGAAGTGCAATCCACGGCCAAGGCGCAGCGCATC
GCGTCGCACACGCACGTCAAAGGTCTTGGTCTCGAGTCGGACGGCTCGGCGCTGCCCATTGGCTCGGGCCTCGTGGGTCAGGAGAAGGCGCGCGAGGCCG
CGGGACTCGTTGTGGAGCTCATCAAGTCCAAGAAAATGGCGGGGCGCGCTTTGCTTTTCGCGGGTGCGCCTGGCACGGGTAAGACGGCCATGGCTCTGGG
TATCTCCCAAGAGTTGGGGCCTAAGGTGCCGTTCTGCCCTATGGTGGGCTCGGAGGTGTACTCGTCCGAGGTCAAGAAAACGGAGATCCTGATGGAGAAC
TTCCGGCGAGCCATCGGCCTCCGCATTAAGGAGAGCAAGGAAGTGTACGAGGGAGAAGTGACGGAGATGACTCCAGAGGAGACGGAGAATCCCCTCGGCG
GCTACGGGAAGACCATCTCCCACGTCATTGTGGGCTTGAAGACCACGAAAGGCTCCAAGCAGCTGAGACTCGATCCCAGCATCTACGAGTCGCTGCAGAA
GGAGAAGGTCTCGGTGGGTGACGTCATCTACATTGAGGCGAACAACGGCAGCGTCAAGCGCGTGGGGCGCTCGGACGCCTATGCGACTGAGTACGACCTT
GAGGCAGAGGAGTACGTGCCCATTCCCAAGGGCGACGTGCACAAGAAGAAGGAGCTGGTACAGGACGTGACGCTCCACGATCTGGATATCGCCAACGCCC
GTCCGCAAGGAGGACAGGATATTATGTCCATGATGGGCCAGATGATGAAGCCCAAGAAGACGGAGATCACGGAGAAGCTGCGCACGGAGATCAACAAGGT
CGTGAACAGATACATTGACCAAGGTGTGGCAGAGCTTGTTCCCGGTGTGCTATTCGTGGATGAGGTGCGTGATGCAGGTGGTCTTGTTTTGGAAGAGTGA
TGAACTAACTTTACATTTTTGTGCTGCTGTAGGTCCACATGTTGGATATTGAGTGCTTCACTTACCTGAACCGCGCGCTGGAGTCGACGCTGGCTCCGAT
CGTGATCTTCGCCACCAACCGCGGTGTCTGCCAGATCCGCGGCACCGACGTTTCGTCTCCGCACGGCGTGCCGCTCGACCTGCTCGATCGCATGCTCATC
ATCCGCACGATGCCCTACTCCGTGGAGGAAATGGTTCAAATTCTCAAGATCCGCGCTGAGGCAGAAAGCATCAAGCTCTTGGACGACGCCACGGTGCGTC
TGGGCGAGATCGGTTCACAGACGTCGTTGCGATACAGTGCTCAGCTGCTGACCCCGTCCCGGATCCTCGCAGAGACTCAAGGCCGCTCCGACGTGTCGGT
GGACGACATCGAGGAGACCAACGACCTGTTTAGCGACGCCAAGCGCTCGGCGCATGCACTCGCGCAGACGGAAGGATACCTTATGTAACGACAGACAAAG
ATACCTGCATCAAAGCGTCTGTCCGCCAAATACAATTGAAGGGTCACTCGCTCATTGACCTCTTGACTCGTGCTCTCCTCCTGTTTCGCTAGATGCAATG
GAATCCATGAACAGTGAAGTTGTGCGGGAGTCTGCAATCTTCGCAGCACTGTCTCCACGAGGGTACTCACGACGTGAACGCCCGCCGGGGAACACGGACC
TTCGAGGCGCTTCGCCAGCAGATGGTGGGGCTGTACCGAGTGGGTCGCTCCCACCGGTGACTCCACGTGATGTAAACGCCATTCTCCGAGCCCCACCGCA
ACAAAGCATGAAGATGTCGCCAAAGACACCTCAATCGCTGATGCTGTCGGTTCCCATGACAACAAGCGAGTGCTGGCTCGTGTGGAAATTCTTGTGCGAT
TGGGTAAAAACGCAGGTAAACATTTACGAGTGCAGCAACTCGAAGATATTATGATCGGACTACATGTATAATAATTGTTTGTGTGGCGATATGTCATAGC
TCGCGATGGAAGTTCCTGCTTCGATCCCTGGTTTCGGGACGTTTTACCTACGGGTCCAGTCTTTAGGCATTCGTATCACGCTTTTTGGTAAGTGAAAATT
CGAGCATGAGACTAGTACCCAGGTTTTGTGCAGTTGTAACTTTTTTCCGGCTTCGTAGAACCTGACAAGCAATTCCTCAACAAGTTTGGGCTTCTAATGG
ATTCGGAGATTCCTGACCCAGCACTTGTTGCCGTGCTGCCCCCAACGATGTCTAATTCCGACACATTGGCATCTACCGGTAGCCGTGGCCGAGCAGCTAG
TGTTATCGGGCTCGGCAATGTCTTTGCATTTAGTTTCGTGGAAATGGCTGCATGCTGTGGGGACGCAGTCGATGCGAAAAGAGCTCAGGAATGGCTCACC
GTGGTCATCCACAAACTGGGAAATGCTTTGAGTCAATGTGGCCGAGTATGTGCAAGCCCACATATTTGCTGGTTGCTTCTATCGCTAACATTTACCGCTA
CTTGCAATAGGTAGAACTAAATATCGGTGTCGGGGTAATCGTGTGTTCTGATCGTATCATTCGACGGCATCTACGCTCACACGATTCGGTATACGCACTA
TGCTATCAAGGCTAGATACATGATGGGAAAAGTTTGGCTAATGAGGTTTGTTTATGCCTACCGCGTAGCGTGCTTCTCCACGACTGGAGTATGAAATTCG
AACAGGAGAAAGTGTTGTCAAACGAAACTTGCGGGCTCAAGCCGCTCTTCAAACCGTCCATACACCAACTAAGAACAGGCATGTCAAGGTTTACGATCGG
TACTTTGTTGCAGCCAAACTAATTATTGCATGTGGTCTCTGTGTGCACGCTTGCAGGTTCTCTTTTTTATCGGGGTCCACCTTTTCTTCATCGATCCAGC
TAAACCCTGTGGTAGACCGATCCAAAGACGTTCCAGACTTCTCGTTTGGGCCGCCAAACCCGCGACCACCGACATTTACTTCTGTGGGAGTTACTTCCGA
CAGTAGGTCGACTCCACTTTCGACTCAGCTAAAAAAGCGATATCAGCGATCACCCAGCCCGCTAATCAATCGTATCAGTACTCATGTGACCGCACCGCAA
CCACCAGCTTATGAAGGGCAAGCAGCAAATAGTACACCGCCAATGCAGAAGCAAACAGAAGAGATTTGGATGCCGCCGCAGCTATTTGATGGACTTAGTC
GGACACTCTGTGTGGAACCTGATCAGAATGTGTCGTTCTTACTTCCCTCGAATCGTATTGGGTCGAACTTCACGGAGTCTGCAGTGTTTCTGATGACAGA
GAAATCCGCGTCTCAATTCGGTCAGCAAACTCAGCACGTCGGGGGGTTGGTATTCATCGACAATCCGAGCTTCACTAATCTTCAGCTGCGACGCAAAAAG
AAAGAGTCGACTGACAAGTCAATATCTGAACAACGATACTTCGAGTATTTGTCCGATGACAAACTAATTGATCCCCGCTTCCTTGCGCCGCTTTCTTCTG
AGCTCGAGACAAGAGTTGTGACCGCCGCTGTGAAGTATATTGTGGGACCATCGAGTAATCATATCGAAAAGGTGATGGAAACAGCGCATGGTGAATTTAC
AGACAATTTCTACTCAAGCGCCAAGAAAGCGATTCTAAACTACCTCTTGATGCGGGCAACATCCTGTGAGCGGCTTGGAATTCCACACGGAGTACCAATT
CACGCCGTCCTCCCAACAAAGTGGAAATGGGGCAGTAGCGATGGACCCAATGGCTGTCTTTCAGACTTAAAGGCTTTGGTTTTAAAACATGGGGGCCGAC
TCACAAACTCCAAGCGCCAAAGGAACACCTATGCGATCCAGCAAACATTAAACACGGAGCGTTCTCGTTACTCGGAGGCAATTCATAATAAGGCCGTGCG
TCGTAAGCGTGTACAGTCAAAATTGATGTCGCTATTGGTTTTGTCGAACCCCCAGGTTCGGGCTCTACGTTTCATGTGGTATGACTTGCACACATCAGCC
ACATTGGTTGATCTCCCAAGCATTGAAGGGCTCAGCGATGTCATCGAACCCATGGATATCATTAAGTTTGAACGAGCTCAGCTCGCTTTTTCTGCGAAAA
TGAAAACCTTTGTCATGGAAAATTGGTACGTGAAAACTAAAATGATGTTCGAAAGTGCCGTCCGAGCCGAAACCTTTTCGATACACACATCAGAGGCAGC
AGTGAACTTTCGCCTGTGCCACCTTTTCGACACCGTAGCGGCAGTAATGTCTCTCCAGCTCCGCTCGCTTATTATGAAGTCAATCCAAGCTTACGTCAAG
TTTTTCGAGCTGTTTGGGACGATAAATGAAGATGAACAGGAAAGCGGCAGTCTACGAGCCCAGGGTCGGTCAGCGCTCTCTGGTTTGCAAACAACGCTGG
TCTTGAATGATGGGCAAATACAAGTAAGTACCGCTTTCATTTAGCAATTATCTTTGCCACGCTAGCTGATGCGTATGATTTCTACTTACAGTTTCGAGAC
CCTCTCGTCGACATTCCAAGTCGCCTGTTGAACGTTCTTCACAACATACCCAAAATGTTTTACAACCTCGGACGCATCGAAACACAATTTGAGGAACCAC
TTGTGCTGTCCAACACTTCTTCACCATTTCTGTGGAACGTAGCTTCACAGGAGGACGACATCGTCGTTGCCACGATTCGAATTCGATCGATCATTGAGCA
CAACCTAACGTTTTTGCGAAAGCTGCAAAGCGAATACGACGTGTTCGCCCTGACACACCGTTACGTGAATTCTGTTGACTGTTTTCACCTGGAGGAAAAC
GGAGAACTAGAAACCTACCGGGCTGAGATGGAACGCGTGCAGGCAACCACTATGCAGCTCGCGATCGACAATAGACATTCACAAAATCTTGGTCTTTTTT
CAGTCGATTGCCGCCTCGTGAACACCAAGTTACACACCGAACTTGCCCAGTGGACTATTCGACTGTTTCAAGCGTTTGAGCAGCGGACAGGTAGAATGAA
TGCTGAGCTTCGGCAGCAGTACAAGGAAATTGCAGCTCGATTGGCAAAGAAACCATTGGATTTGTACGAACTCGTCGATGCCGAGACATTTGTGCAGTCG
CTAAAAGCAGCTAAGCTACAAGAACTTCAAGACCGGGGTAACTCTATCAAGCAGCGCCTTCGGTTCTTGCTATTTGAGCGAGAAAATATGCACATTGGTA
ATCTTGCAATTGACTGGCCTCCAGATGCACCGCCAAACGATGAAAGTGACGCTTCATCCGTACAGGTGGCAGGTTTCCGTCTCTCGGTTGATCTCCTCTC
TTCGACAGCGAAGACTGTCAAATGGCGTAGTCATATTGAGAAGTTGCTGAAAGAAGCCGAATCGCTGCTTGTAAACGAACGTGCACGAATTGAGGCCATG
TTTATTGCGAAAAGGTCTCGATTTCAGGCTGAAATTGAGGAGTTTGAGAGCGAGGTTAGAGGGTTTGCAAAGAAAGGAGATCTACGACATGCCGCTACGT
ATGTTGTTCAGCTTGCAAAAATGAAGGACAACATGTTTATTTTCCGGCAGGCGATGGAGACTATCGTAAAGGAAGAGCGAAAGCTACAGTGGAAGCCAAC
GGATTTCGGCAAACTCGATGATATAGCAGAGGAGATGGCACCATATGAGCAGCTGTGGAAGACCGTAAGAGAATTTCGCGAGATGAACTCGCGGTGGTTA
CGTGGGAATGTATTCGAGCTACCAGGAAAGGAAGGAGTCCAAACTCTGCAGCAAATGCTCACTGTCGTTGCCAACGTGTCAAGCGTGCTCCTTTTGAACT
CAGCCGCGGCGGCAATCACTGCAGAAACAGTTCGAAAGCAAATGACAGACTTTCGTGAGAACGTTCGGCTAATAATTGCCATTCAAAATCCAGCGATCAA
AGAGCGGCACATGAAAGCGGTGTCTGGGCTCATCGGACTGGACTTTAGCTCTGAAGAAACTATCACGTTGTTAAAATTACTTGAGAATGGAGCTTTTGAA
ATGGTGAATGAGATCGTCGATATCAGCTGCAATGCAACACAGGAACAACAGATTGA