Description :
From Genome Similarity Track
Location :
Scaffold_1880:648- 2538
Sequence
1890 bases(100 bases per row)
TAGTCCGCTTCCATCATTTCCATACTGATAGGCACTGGAGGGTTTAACGCGCCCCTTAGCTGGGATCAGGTTTTCAGCGATCTCATCCAAGTGTTCTCTG
GGGGTAATACCCGCACCCAGAATTGCAGCCAAGCCGTCTTCATCCCGTTGAACTCTGCGTATCTCCAGGTTCCAGTGGGACAACTTCAGACCCCACTTCA
CCGTTCGACCGTCTGCCGACTGCGAGGTCAGCAACCACTTCAACACAGAATATCGCGTGTAGACGACGAGCTTAGGGCTGCCTTCAACCAAAGTGCGAAA
CACCTCCAGGACTCTCAGGATAGCAATCACCTCCTTTTCTGCAATGTGATACCGCAGCTCAGCGTCATTCAAGAAGCGACCTGTGAATCGAACCGGGTGC
ACAATCCCGTCGTTCTCCTGGCCCAACACAGCGGATGCTGCCCACGGGTTCGCGTGGGGAGTAATCACGAAGGGCCTTGAACGATCTGGATGTCTGAGCA
ACGGAGTCGAAACGATCTTGCGCTTCAGGATTTCAAAAGCTTCCTGGGCTCTCGACAGGTCTCTCCTGGATTTCACTTGTTCCTCAGTCAGCTCGTCGTC
GGGAACGGCAAGTCTTGGACCCCCTTCGCGATTTTAGGGGTCGCTAGGATGCCCTCAGCACTAATCTCGTGAGAGAGGTACGGAATGGACAACTTCCCGA
ATTCGCTATTGGGAAGACTCACAGAGATATTCCAGTAACGTAGTCGGAAAAGCAGCGCGTTCAGATCCTGGCACAGCTGCTCCCAAGTAGGCGCACCGTG
GGCGATGTCGTCGATATACGAGCTTCGACCCAGGACAGGGCCCATCTGAGAGGGAGCCGGGATGTTACGCTGAAAAACAGTCATCTCATCCATCAACACT
GAAAGTCGCGGTGCATTTTCACCTGAAACTCTGGGTTCCCCAGGGTTCAACCCCAAAAAGTACAAGACATCTTGGTCGACCTCAGCTTCTTCCTCAGGGG
GAAGCCGCAGAAAACCCCACAGACAGTTATTGAGAACTGCCTGGTAGATCAGCGGCGCGTTCTTGAGGCCAAACGGCATCCTTACCCACTGGTAGTGCCC
ATAGGGACAGACGAACGCAGAGATCAACTTGGCTCTCTCGGTCATCTTGATAGCCCAGAAACCACTCGCCATGCCCAAGCTCATAAACCACATCGCCGAC
TCAAAGCCAATCAAAAGATCATCAATAAGCGGCAGCGGATAGTGTGAGAGCTTGATGAAGCCATTCACCACGCGATAGTCGATGCACATCCGGATGTCGA
CGCCATTCTTCTTGAGGATGATCACGATTGGAGATGCCCAGGGGGACGTAGAAGTCTCGATCAGCCCGTTCTCCAGAAGCTTCTTCAGAAGTTTATACAC
CTTAGTCCACAGGTGTGGTGCAATGGACCTTGGACGCTGGGCAACAGGTTTAGCGTCGCCTACATCCAGGTCACAAACCACTCCACGAGCAGGTGGGGGA
GCTGCATTGCCGTCTCCCAAGAAGATCTTCCGATGATACTCCAGAATTCGCCTCACTTGGTCTTCCATCTCGGGCGTCGTTTTCCCAGGGACTCCAACAT
CTGCCTCCTCGATCTTGCACTCAGGGGTCAAGTCACGCATCTCAGGAAGCATAACCAACTGGTCACGCAACTGAGAGAGCAACTCACTTCCCTCACGTAT
GGAGACCGCAGAACGTCACCCAAGTCACTCGTATCAACAGCAACATCTCGGAGTTCAGGAGGGTCTTCAGGAGGCACTCCTTCAGTCTGAGTTGCAGCGT
CTTCAGCGAAGCGCACGTGATGAGGCTTCGGTTTCCTGAGAATCGAGGCAAGCAGTGCCATGTCGGGGCCCTTTGCAGGTCGCCGCAGAA