Description :
From Genome Similarity Track
Location :
Scaffold_325:648- 2440
Sequence
1792 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGACGAAAACGAGCACAAGAAAAGCAAGCAGTACGAGACTGGATATCT
AAGATCAAAACAAAAGAAGTAGTAGTAGGAACGTAGGCTACACAGCTATACCCGCATCAATATCGCATCCATAAACCAATCGTCGCGTGGCCGGCTTCGC
TTGCGTTTCTCGGACATAACTGCAGCGGCGTGGCCGTGACCCACGCGCTCGTTCACTAGCACCGCACAACTGCGTGGGATTGGGGGCGACGATCGTATGT
GAGCTTCGGGAGGACAAGCGCCGAGCCGTCGGCTCACGCCGTGAATCTCCGAGAGCGTGACGTGGCTCAGGGTGCGAGACACGAGCCCATCGGGGCGGGG
GCGCTCGCGGCTNNNNNNNNNNCACTGTGATCCGATATGCACAAGATCAGTACTACCGGCTCATAGAATCAATCGCATGACCAGCATTGCTCTGCCAATC
TACTCATATTCAACCATGATCTGTTAACCATCATTCTGCCTTTGCACAGGAAATCCGCCGAGGAAAAACACGAGCGGGTGACGCAAGGGCATGCGCCGCG
CGCTCCACGGCCGTGTACATGGTAAAGNNNNNNNNNNATGTCGAAAGCGTCGACCGACGCTGGCACTTGGGATGCAAGAGCTCCCGGATGGAAAGGAAAG
GGAAAATGGAAGGTTTGCCTCATCCCATATGCACAAGTTCAGTACTATTGGCTCATGAAATCAGTCGCATAGCCAGCATTGCTCTGCCAATCTACTGATA
TTCCACCAGGATCTGTCGACCATCATTTGCGAGAAACACAAGAGGATCTTCTCGAGATTCGTCTCTTCACCTTTCATCTGCGACTNNNNNNNNNNATGGT
GTGGGAACGACTGCGATCCAACGCGCCAGCGCAGCTCCCAAGGCGTCCAAGGTCGGGTCGACTGCGAGCGTCTAAGAGACTGAGAGGATTAACCAGAAGC
GGTCAATGACCGACGTCTTGAGTCGGGCCGACTTTGCTCTCTATGGTCGTGGGTGAAATTGCTGCAAGCAAGAGAGAACGGAGGAGGAAACGGAAGTAAT
AGCTGTGTAAATTACTGGACGCACACGCTCATGTGCCTGCGGTGTCNNNNNNNNNNGCCTACCGAGTATATCGGCTTTGCTCGCTACGGACGTGGGTGAA
GTCGCTGCAAGCAAGAGAGAACTGAGGGGAGAACGAACGTAATAGTGTAATTCACTGGACGTAAACGCTCATGTGCCTGCGGTGTCTCTCTAACCAAGCA
CAATGGCCTTTTCTAACTAAAGCAGATGAACTTGATCCCTGCTTGGGAGGCTTCAGAGCGCATGAGCCATGAGAGCGAGGGCGCGTTCGGCCAAACGATA
TCCAGCGCCACCCAACTGAAGAATGGTCGCGCCCGTCCAGACGATGGACGCGATCATGAAGTCGTCAATCTTGATGATGACAAAGCAGCCCGCTCGCCAG
CAGAGGACGGAGACAAAAATCCCATAGTTGGCGACGTTTAGGATGCCACGAGCGAGCAGTTGGACACCGGCCACACCCAAGTGGAGAGCGGTTGTGAGAG
CGTTCCACGTCCAAACGACGACAGCGGTGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACAAAGTTGACGA
CGTTGGCAATGGAGCGCGCAAGTAGTCGGATGGCAGCCACGCCCAATTCGAGACCGGTCGCGAGAGCGATTGTGAGCGAAACACCGATAGAG