Description :
From Genome Similarity Track
Location :
Scaffold_58:64792- 66163
Transcript NameFunction/comments
Phyca_LT1534553959Major Facilitator Superfamily (MFS)

Sequence
1371 bases(100 bases per row)
gactccgacaacccaagcgccatgcagaagatcggcaagcaaggagccattgtgctgctatgctgcatcaatctgcttaactacattgaccgtggaatta
tcccaggagctcctgagaagtttaaccagttcatcacggataccctgggcgtgagtgtgctgcgccaatccgtgtacttcggtctcctcacgtcggcctt
cattgccagttactccatcttctccattgcgtttggctactttgcacttacacacagacccttccgtatcatcgcgttgggtatgtcagtgtgggtggtg
gccgtggccatttgtggtattgctcagtccaccgaaagttactacgtgctcattatcggtcggctccttagtggtgttggtgaagcctcatttcagtgca
cggcaacgccgtttattaaccgctacgcaccaccggccaagcgctcgctgtatttgggcatctatctggcctctatcacggtgggtactgctgtcggcta
catctacggatccatttttgcgagctctagcttcggttgggccggagcctactacctcgagggtcttcttatggtcggattcattgtctgctgtcttacg
atcgtgccggatgagctgaaccagatcccaagcaatgcgccagacgcagaagagcacgacaacaaggacgagaatatgtcagtggtgcacacccctgaag
acctcgagaaggctagcgcgaccgcattcctggaagataaagaccgtagctcagtcatgcccaagccgtcgttttttgtggagtggtgggctatcttcag
caacgtgccgttcatgctgattatcctcggacacgcggcctacacgttctcgctcgccgccatgagcaccttcagccctgctatcttcatcggtttgggg
ctgttcgagagcgagacgacggtgtcacttatgttcggcggtcttgtggctatcaccggcactatcggtacacctttggggggaattctggtcgactatc
tggcgaagaagaaccccagtgagattggccgccgctgcatgatctccgttcaagccctgttttacttcatgctggccgcagttgtgtttggactcgtgat
ggtggcattcgcgaccactaagatgttgtgtctgatcttccttacgttgtgcctcttcttcatgtgcgcactgtccgtgcccgagactattgcggtactg
gagcttttccccaagtcccgacagtcgatggccgttgcagctaacacgctgatcatccacgcgctaggtgacgtaccatctcctatcgttctaggactta
tcaaggactcgtgggccccccattgtggcactgtggaaattgacggtgaagcaaagctgaacccggactgc