Description :
From Genome Similarity Track
Location :
Scaffold_180:6479- 29688
Transcript NameFunction/comments
g6646.t1RAW27698.1 hypothetical protein PC110_g15902 [Phytophthora cactorum
g6647.t1POM72023.1 Transposase [Phytophthora palmivora var. palmivora
g6648.t1XP_009526794.1 hypothetical protein PHYSODRAFT_255846 [Phytophthora sojae
g6649.t1hypothetical protein

Sequence
23209 bases(100 bases per row)
TGGTGAGAGAGTTCGAAAACGGAGCTCTCAAGAAATTGACTTGGATTTTGTATGGTAGGTTGATCGTCGACGGTTGCAATGCGCGCGAAAACCGGAGCTG
TAAGCTGCCTTGGGCGCGAACACGTCGGGTGAGGTGGGTGCAGATGTGGAGCACATCAGGTTATGGCCGTGTCTTATTTGGGGTTACACTAAAAGAAAGC
ATTTTTATTTCTGCTTTTTTAGGAAAGCGGAGCTCTGCTTGGGGAGAGCTCTTAAGTATCCCAGCGAACCGTAGCACAATTGTCTCTTGTGTAAATTATA
TTTTACGAATATTCTTACCTTTCATACAATTAAGCATAGTCATAGATTAGGAAAACATTGACATGATAGCTAAGTTACGAGTTATTCGACACTTATACGA
GCTATTTAACACTTATATGGAGTAGTCGACGTACATATTGCACTTTTAACAAGCATTACGAACGGTAGCGAAAAAGAAGAAAAGGAGCCATGCGTCGTCC
GGCATTCGTCCCTACGAGCAATCAGAAAGCGCGTACCACCGCGATTGCAGCATTCGAGCGGATGCTGCTGGAAGACCATTCGAGGAACACCAATACATTG
TTGACGCGTTGTGTAAAGTGTTTTGAAGTTCGCTATGGATCGAGCCCAGACGTCGATGGTTTCGTCAAAATGCTGCCGATCTCCGAACGGGACGTGGTTT
ATTCCGCATATTCCACAGATTACAAGCAAAACTCAGCACGACTTCTTATGGATGATACAATGGCTAGAGATCTGCATGACGTTGTCACAGGTATGACTCA
CGTCCGTGCGGCGGCAGAACGTATTGTATTGATATGTACTAACCGTAACTCTGGTAGATAATAATCGACATGGTTCGTGCACGTAAATGGTGCATCATGG
AATATATCTACAAGAACAGAAATGTCCCAAATAACAGCGGCAATGGGTGGTGGTGGAACCCTAACGGGACCCCCGGCAGTTCCAGCCCGCAGATCTCGTT
GATAAAGACAAGCTCTAGAAGATGGAGGAGCTGTTGACGAAGGTGAATCAGGCTCACCGAATTGCTCATATAAAGTACTGGATGAACAAGATGGAGAAAT
GCTACTGCGATTGATGTGTTTATGATCGTTCTTCTAGTCGGTTAACGAATCAAACTACAGCTCTATCGTATGCCGTTTTTCGAGTCAGTAGGCTACAAGG
GAATATCGACAGAATAAACATGCACCTGACACTTGTCTCTTGCTCGTCGATCTCCAAGGTCAGGCGCACTCATTTCGATGGCGTCGAGGCTTTGTAAGTT
TTTCACAGTGTCGATGCCCGCCACAACATTCCTACTGGAGTTCCAGCAATACGTTCGAGAACTCGCTTCGGGCACGTAATAGTTGGCGTTTGTAAGCATA
TGTTCATATTTATAGAGCCATATCTGGTAGCCCGCATAGTTGACCCCGCTACCGGTGCGTATTTCAACAATCATGATCTCATTGACTATGGAAGTCCCAG
AACGTAGGCTGCCCCCTCCCCCCCGGCAGAACTTTCTTTACTTCTTTAACGCTCTGGCAGATGATTAATCTCCTGGATGAAATAGCGATCGCAGAAGTTC
CTAACCTTCCTTCATTGAAGCAGAGGGCACCATCATAGTTTTCACTTCGGTCGAGTCGTCAGGTTTTCGGCGCAACCAAGGTGGGCGTGGTAATTGCTTC
GATTTAAACCAGATTGGCGATTTCCGGCAGAACAGCTCTCTGACCCCGACAAAGATGAGTCGTGACGAGGCCACTTGGGTTCTGGGTTTGGAAAACGGCG
ATGTGCTGCGATATTTTTGTCTCTATCTGTGGCCGCCGCGTCATATAATCTAAGCAACGTTAAAGGGTATTCGTTTGACCCATCTAAGAATCAACATTTA
ATTTAACCTCAGTAATATGGATAATATTTAACGGATTAAAACTGTGCTTCGAAGCTTGTGATTGGTCATAAACATTGGCTAAAAGACATATCAGTGACCC
CCCCTCCTAATATATACAAATCAATGCGACTAGGACTCACTGGGTACCAAACGAGTAAGCAACAGATAAACGCATAGGAAAGTGTTTGTGATTACAGTTA
ATATTGGCAACAAGGTAAGGCCATATCGATATAAAAAAACTAATGACATCAAAATCGCCTAAATTAATCATGTTATCTTTTTACTGTTTTATCTATTTTT
AGAAAGTCTATAGTATCACACGATAGTCCCAATGCTCAGCTTTATCGTGAGGTAACACATATCCCTGTTAGACATTCTACAAAATATTATGACTTAAAAA
CTCAAATGTTGGTTCTGACGAGTGTGACGAACCGATGACGGTCCTGGCTGATTCAGGGGGCGTTGTATAACTTTACGCCAAACTTTAATATGATTAGAAA
CACTTGTGCTATTGAAATTTCTAATAGCAATACTCGTGCATATGTTCGTGTACCCGTTGGACCCACTGTGTTAACACGCACGATTTCCCAACCTTCGAAC
GTGATGATGGACGACTTTGGCTTGGTCGAATCGTTCACAGACGCTGAGATGGATGATCGATACGATCATATCATCGGTGTGTTTTGGATTAGCATGTTTG
CGCCATGAATTGGCGGGTGAAATCGCACCATGCTCGCCCAGACAAGTCTGATCGAGAAGGGACACCCGGTGCACAAAGCAGTCGATCTATGGACGCTCAC
ACAAGCAAATACAACCGTGTTGTGGCTCGCGCAGGAGCGGATTGTTGAGCAGACCCCCCCCCCCTCCCCTCCCTTCACTCCGCAAGGTTGCCAAACTGAT
GCTCCAATACAGCTTGATGAGAAAGGCGTTAAGCGCGAAGCATTCACATTTTAGGTACAGTCAGACTACCCAACTCGCATCAGCCCGTATTGGTGGAAAC
GAATTCAGTTCAGTGTCTTGGCGAACACCTCACGGTCCTGACGTGTCGAGCCAGGAATCGCCGCCATCCTGAGAGCCCTCGTCGTGGTCGTCGTGATCTC
CGATGTCTCTGTCGAGCCAGGCGTCCATGCCCGGGTCCCATACGGACCGGTGATTAGTCACGAATGCTGTAAATTGCTGTGAGTCGATAGAGTTTTGGGT
CCTATTGACTGAGCTGGCTGCAAGTGGTGCCTCACAGCTTGTTCACTCCATATGTAGGCGACTCAATCGCCTTTGTGTCGACACGCTTGGGTCCAGAAGA
AATATAATATCATTTGTCCAAAACGTCTTATTGCCCGATGGAGTGCTTCCTGTCGGGCTAATCATGGTGGGCACCTCTTGGTCAAATCGCACCTAGTATC
TGATTGCTACCATTCTGGATATAGTGACATCCTACATCACATGAATTTGTTTGTCGTTTAACCGCTATCGTGCGTAGCTAGTCAGGTACTTGGCGAGAGA
GGACTTCAAGACGAACAATTAAAAATGTGTCTGACTCTTCCAATTTGTTAACTATATACCAAACACTAATCGACAGTTTGCCAACAGTGTGAGCAGCAAT
ACGTATAGCATTCCCACAGACGCCCCCATCGAACCATGAGTTTGCGTACGAGTAGACCGGCGTCATACTGTAGCAGGACAAAGACAAGCATCTTGGTTGA
TCAGTGTGGGCAACTTGTTCGACTTGAACGAAGATACGGTGCTGGATTAACTGCGCAGTACCACGGTCGAAAGTAGGCAACATGCGTACAACAACGGTAC
TAATATCCAGTTGAGCGGCGAAGGCGGTGGGTGTATGTGGAGTATCCACATCAGTATATAAACACGTCGCGATATCGGAGCTGGTTGCCGACAAAAACTG
GTACAAGTGAAGTGTTGGTCCAGGCCGGAGGGAGTATCAAACGACATCGAAGATTACAGCTAAGATACTTGAACGTGCGTTAGTGTCCATAACAATACTG
TACTCGTGTCCACATCATTGTAATACCATCCATGTCGTACGCGGTTGTAAATTACGCGATTGGGTTATGACATACATATATCTGAAGTTGGTGCTAGCAT
ACTATGTTTTGTAATGGGAGCGACACCATCTTGCATAGAGAAAGTGTACGATCAACAAAATACCCCCCCCCCCCCCCCCCCACCCCACCCCACCCCTCTT
CCCGGCACACAAATAGCGAAAGACTGGATAGACCGGTTTCTTGCTTCATCATCAGGGACCTGTTGGCCAACATCCCTAGGATGTCATCGGATACAGGTCT
CCGGGCACTCACGGCTTTCAGCGTGAGTACTGCTCCCAGCGCTTACTGGCACATCTTGCATACGGTCGACACCCCATCAATTGCCAATTTGAACAACTTG
AACATTGTTGTCACACACTTGGTGCACGACACCTTCCACCGATAACCCTTTCCACGTCTTCAACATCGGCGGGGGTCCAGCTCGTAGATAGTGCAGTTGG
ACTCAGGTCCACTTTATTTTTTCTAACTCGATAAAACACAATCTTGTTCGGCAAAGCTGGGGGGGGGGGGGGGGGGAGAGAGAGAGAGAGGGGGGCTCCG
GAATGTTACGCGGAGGACAAGACAGGACAGTAAATATCACAGAAACTTCGATACCTTTCAATCTGAACGGTGGCTCGAACAGCTGTTCAAGATGCTGGAG
GACTACATTGGGTATGATATCCATGTGGCTGAGATTTCGTACTGAAACACTATGCCAGCCCACAGCAGACAACACATTTGTGAAAAGCAGTAGTACAAGA
TTCGTCGACGAAAAAGGTATATGCCTTTTTTGAAGTCGGGTGCACTTACAGTAACTTGGTGTTTGTGCTGGGCCATTCCTATTCTGATGTTTCGCTTAGA
GCGTGACATAGCGCAAAACTGTCCTCCGCTTAGGAATCACAACAGATCACGACCATTTTATACTCTACATGCCGCACTATTCCCCGAATTTCAGTCTATT
AAGCCAATGTGGGCGGAGGTCCAGGGGGGCGATTGTACGAGATTCAATATTAAAGGGTGCAGCTCTGCAATGATAAGGCCAGAAAACAACTTAGTGTGAA
GGACAGTGCTGTGTGGGTAGGTATCTACAGTACGAAGTACGAGGATCCAACATTAAAGCGTATGCCAATAATCCCTTTGGTTGAGAGGATAGAGGAGTGC
AATGAGAACGGTGGCAGCTCGGACGAATACACATCGTAAGGATCAGACAACGAGCATTTACTACCGAATATGTTCGTAATGAACGAGGAGGGCTAGAAGT
TGCGGAACAAGGAAAAGACGACATCTCTTTTTCCTGGGCGTCACGGGTAGCTGAGAACTATTTATTCTTCGATTAAGCTCGTAGCTAGCAAGACTCCTCC
ATACCGACAAGCGATTTTTTCTAATCAACATCCATGTCCAACCACCCGGTCTCCGCCTTTTTCAAGTCCGACCTGTTGGGAATGACTGGTTATGGCTATG
ATCAGGCGGTGCTACCGGACACGAACGATCTGACCGTGATGGTAGACGTGCATTGGGTGAATGCTGGACGCTGAGGATCCTTGGACGACATGGTGGTTCG
GCGACCAAGGGCAGAGTTGCTGCCGTGTGCAGTGTCAGATAAAGAAGCGACTAAAGGGATTAGATTCAACATAGACGGCTATATCTGTATTACTCGTGCT
TCATCATCCTGTCCAATACGGTGCCATGATCGGCCACAACTGAGATCCCGTCGGATACATGGCCGTGATCCACATTTCGTTTGGCGACGATGTGGAACCC
TGTAGCATTTAAACCACACGATATCGACGTACTGGATTATGCTGCCTATTCTTTACGACCCTGCCTCAATAAGTCAATATGAGGCTTGATATCAGTCAAA
ATGCGTGCTGTCCATGTTGCCGCTCTTAACCACTTCAACGACACAGGCTGCAGGGCAACAAGGAACGAGAACAGCTTTATCACGCTCGACGACATGTCCA
AGGGAAACGTTCACTGGGTTGACGAACGCTTCGAATGGATGTACATATTGCAGGCCCAAGGCAAAATCAAAGATGTGCAGGCTGTGCGTATGTCATTCCA
TTAAGTAGGTGGGTCATTTACGCGTTTAATGCAAGTGTCGACTCACTCAGTCCGAACAACGGATGGATCATCTTAAGCGGGCCTACCATAACCAGTCAAG
CTGGGGAGGTACGCGGCAAGCTGAAATCAATCGCTTAGTGAAAGAAGTAAAATGGGAATGACCGGAGATATCAGGAGCACTGATGAAAATACTGCCGATA
GTGAACGGCAAATATCTCTGCATGAAGTACTTGTTTAACATGGCTTGTCCAAGCTACCGTAAAGGGTGTTTCGCGAAGGGCAGGGGCCACTTTTGTCTCG
ACAGCATCCCATCAGAGATGCATGATGCCATTATGCAGTCCCATGGTTGGTTCAAGTCTGAGTTGTAAGGCTCGCGGTGGGGTCTGATAGCGCGTGACGT
CTTTCGCTCTCGTCCGGGAACGAATCTCCCGCACAGTTGTCTGCTCGTTCCTCAAGTGAATCATGCTTCGAGGCTGGGGTGGGCCTTTCGCCTCATTAGA
GTGACTCAATTCCGGATAGCAACAGTCGTCTAAACTCTATGAGGGATCCGCTTGGGACCAATAGTAGGGTCACGGGCTCTGTTGCTTTGTCTCAATCCAG
TGAGAGGACCGCCAGCTCTGCTGGGAGGTCTAAGCCTAAAGACAGGGTCACAATATCTGCTGAAAATCAGCGCCCAGTAAGCACCTCACGAGATCACCTG
GTCCTTCGACTCCATAGTGGTAATTGTACGGGGGCTACATCAAGTGGCAACACACAACAGTCATTTATCGCGCAGCAATATCACCGCCGTAATGCAACGT
TGTCAGTTCGCCGTAAACTTCTGAGCCACGATCGCGAGATTGTACTAGCAGCTGTGGATGCTAAACTTGCTGACTATAGTTTATCGATATCCCGAAAGAC
ACTACCAGGACTACCAGAACAGATATGCACCACAAACACGCTCGGCCGGGAGAAACAGCGAATATACAGCGAGTTTATTCAACGGTCTGGCACGCCAGTG
TCCGAATTTGTACGAGTTCTTCGCGGAGAAACAGAATTGGACCCACGTCCTAACACGGTGTGAGAGACTACGTCAGATTTACCCAGTTGGGCTACTTACT
CGTACCGTCAACAATGGGAGGAGGTGGCTCCTCATGGGGTTATTCCGGAATGGTATGCAGAATTTGTCTCTCAGACTTCAGCCCAACCTAAACATTCATC
TATGTATGAGGCTTTGAGGTCAACCGAAAAGAGTATTCGCAAAGGTGAAGACAAACAACCAATATCTCGTTCTTGACATCGATTTACTCGACATTTTGCC
GGGGATCGCGTTCAGTCCACGCGCGACCAAGAAAGACAGTTTGCCGTTGTCTGAATGTGCGAGAATGATTCACGACATATCGTACTCGATGGGCGCATCA
GCGAACAAGAATACCGAGACAATGAGTTGATTCAGGTGACGTACGACGGCCCGCCGGCTCTGGCTCGTCGAATCCTATACATCATCGCAGCTTTTCCAAG
GCGCGCAAAAATGATGTATCGTTATGTAAACGGTGCTTTTCGCAATGTTCATATTCATGCGGACCATGTAATGCGGTTTTCGGGTGTGATCCCGGAGCTA
GGCGTGCTGGTGATTGATCTCGCATGCCCGTTTGGCTGGAAATTCTTGCCCATGCAGCACTGGTTTGTTGGTTCTTGAATTATTAATCCTTACGCTAATT
CAAAACCTTCCAGCCCTAGTCAACCGTCGACGACCGCCACCAACTTTGATGAGAAGACTTGGTGCGACGATCATACTTCAACCCAGTCTGAAATTGGTTC
AATGCTTGACGAAGTGAACCTGACATTGCGTGGCGCACTGATTGCTGTGGCGGAGCGGGATCGCAAAAATGGATGATACAATCCAAGCTCACCAGCGGTA
CGCCCGGACTGTCGAACTATCGGAGGGGGTACTCCGTTGATCAGGCGTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGAGGCCGGTTACG
CTCTTCCGATGCTCACATGAAGGACGTCAAGGGGGTGACCAAGGCAGAACTGTGGAGCTGGACTGCTCCTTCCGGGGAATGGGGGGGGGGGGGGAACGGC
CACGCGGGTATTCTTCACGCGGTCGTCAGTTGTCCGTGATCGGGTCTTGGGCAAGTTGATCACGTGGGGGGGGGGGGGGGGGGGGGGGGTGGGTGCTGCT
ATAGCCCTTTCAGTTGCTTGCCGCCGCCTCTGGCGGGGTCTTGAGTTGAGATGAGACTATACGATCGCCCCCTGGCCAAGCTATCCAGATATGCGTCGCG
TACTTTGTTGACTTGGTGAGTCCTTCTTCGGGTAGGCCAATGTACGGAATGTGTGGACGCCACTTGTGCCTTGCAAGGCAAATCAGGATCTATTTTAGCA
AAGGTAAAAGTCCTAAAAATCTCTCTCCCTATCCCCATCTCATTTGCGTGCCCACCGACTGCACAGCACATCTGAGCTTCAATCTGTATATCTTGACCTC
GTATCGGAATGATAGTACCGTTTTACCCAGTATCCATCTGATCCAACTGTGGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGGATGCCCAG
ATGATCGCAGATGTCCGGGTGATCGCAGATGTCCGGGTGATCGCAGGTGTCCGGGTGATCGCAGGTGTCCGGGTGATCGACTGTACCGAAAGGGTGGTAC
CAGGCAAATAAAATTACCTGTACTATCGTTGTGGTACCAAGTCAGGCACTGGGGCTATCCGAATATATCCCGCACCAACCCCAACCCGTCTGGTCCAATC
AGTCCAGACGCGATCTCTTCCCATCATCGGCAATTTGACTCAGGTCGCTTCACCTCATTGCTGTTCTCGGCCTGGAAGCAATTAACGAGGATAAGGTTAC
CACCTGGTCAGCCCGCTGCAAAGCGCTCGGACTCCTGTGGATTACGTCGGCATTATCGGAGCCATACCACCGAGAAAAAAAGGTGCAAGGCCTTCCGTCA
AGTCGAGAGTATGTTGGAGTCACCACGCACGACAAAAACGTATCTAGAGAAACTGTTGGGAAGCTCACGTCACGTGATGACGTATCTGGCCTCCAACAAC
CTTCTTTCACTGTTTAGCGGTGTTAACACGAACATCTCATCGCTATTTAAACGTTACAATAAGTCAGGGGGCCCAAGATAATTTATACTGGTTTCGTCTA
ATCCTACGAACGGCAATTTTTGAACTGGATACCCTTAGCGCGATTCACAATGACACAGCCTGTCGACTACAAGGTAGTTATGGATGCTAGCGATTTTGGA
CTGTGTGCACTATTCCGGTCACGACGTGAGTTTCTCCAATTTCTCTTCAATTCCAATGAAGTGAAACAGATTGGAGCTATTATGTAGGACAACTCCGGCG
ACTCAGGAAAAAATCTTCCCGAGCTTGTGAGCGCGGTCGTTTCTTGTGTGGTATGGGGAAAATATTGGCAATGTTTGGAATCACACTCCAGACGGGATAG
ATAATCAGTTTGCCGTATCTTGGACAAATAGCAGGGCGAGCAGAAAGTTACGGCTCAAACGCTGCTTAGAATGCTGGGTTTGATGGAGATTCGATACAGG
TTTTACATTACAGCTTCTCACATTCCTGGTGTGGAGAATATAATGGCCTATGCAGGATTTCGGGCGTGGCAATTTCGGGCGAAAGCCGAATTTTTGACTA
ACCTATCTTCTGAATGGATCCAGGTAAGAGTGCCATCCGGCTTCAGGAAGTTATCAATTTTCTGTGAGCGGTGCTGCGAGCTGGGGCGTTGGCCGACTTA
AGCCGAACTCACAACAGAAGAGCATGGAACCAATGTACGACGTGGTGCCACTGGTTAAACTACCCGATATGGCTGCCGAAACACGATATTCACGAAAAAG
CTGCACAACTCGGATCATTTACGGTGTATCTGTGGTGCTACGGCATGAACATGACAGGCCAAAGAAATTCATATTTAACGATATGTGCCAAAATTTGTGC
CATACGCTGGTACCACAGCCATAGCCTCGGGTACGATCGGGGGGTGGGGTGAACGCTAGCCACGCATTACTACTCCGCAGAATTAGACACTTTACAAACC
CTGTGGTCAAGCGGCATATGCTCTCACCCACGTATTTGCGAAATTCTTGACTTTCTGCATGATCATGTGGGGTAGAATGCTTCTTACACTTTTTCTGTTA
AGAAGGTCGAAATACTTGTTTATACACAAGTGTCCTCACTAGTATGTCCTACGACTTGGAGATATTTTCTTTCTGGACAACCAGAATGTGCAGACCACGC
CGCGCAAGGCATCACGGGTGGGCAATCGACTGTGTGACGCAAAAAATAACCAAGTCGACAGGGAGGCGTTCCGATACCACCATAAGTATGGTGATAGTGC
ACTACGGTCAGTGCGAGCAGCACGGGTGGATCATCAGGCGGCAAAAGTATTTAAAACCCAAGCGGTCCGACGTACCCTGTCGACGAACTCATCTAGCGGC
ATACGTACACGAGAAATGGCAGCATTAATTAAGGAGGCAGCGAGAATTGAAGGACTAGATCCTAAGCGTGATTCTACCCACTCAATCCGGATTGGCAGTA
GTGCGACGGTGTTACTCGATGCAGGTGCTGACAGGCTATCACGCTCCTGTGGCGTTGGCTGTCAAACGTTTTCGAGTAGTACGCAGTACGCACAGCAGAA
GGATCATCAGGGTTATCAAGGCTAATGTGCTGAAGTAATTGTACAGCAACCAGACGTAGCAGATGTGGAACAGTCTTCACGCGGGAATTCGCGGCGGAAA
TTATGGTGGGGTGCTATCACTCTATTTCCACAAGGAAACATAAAGTCATTTATAACAAACAAAACTGAGCGTATTCCGGTAACGTCCGTATATCCATGAA
GCGCTGGCGGGACTAAAGAAAGTCCGTGCTCCAATACGAATTAGGATGTTGGATAAGGTTGCTTACGGAACGGGTACACCAACAACCGACATTATGGAGA
AACGCTCAGGTCTTCTTCTACGATAGCATGTGACACCTGCGGTACCCTATATTTTCACTTCTGTGAACTTAAAGAAAACTTTTACACTGGTTGTATTCAA
GGGTGCCAGTGCTATTTTAAAGTGCGGTTGTCAAGTGTATAGCTATCCTGACGGGTGCATCAATTGAAGGAAGATCATTTTCTCCAGAGCTACTCACTGC
AAAGGACCTGCGGCAATTCATTCCGCCATGAGTCCGCTGGGCTGACTCTTTGTCAGTTGAGTGTTGGGATCGGTGTACATGCTCGAAACCCTATTGCCGC
AGGCGTGATCATTGCATAGTATTGTATTGTAATGGCGCACTACAACACTGGTCAGGTCACCGAGTTTGAGGTAAATGTTGCACCACTGGGTATTTTCAGT
TATTTATCAATACTGTCAGTTCTAATATTTCGGTGTTCAAACGGGCGGCTCCTATCAACCGAGGAAGACCGCGCTCGTACGATCTTGATGCAATTGCACC
CGCCGTTCGAGGGTTTGTGGTGGTAGAAAATCTTGCTGGCCGGCCGATTACAGCACGAAACGTCTGTGACGAGGTGGCGGACGTTTGTGGCGTACGCCTC
AGCGTGTCTACCATGCCACAGGCACTTCATGAGCTGGACCTCCAACATCTCAAGGGCGATAAGCGCCACATCTACGCAGAGTCGCCCTGCAACATCGCAT
TCCGGTGCTCCTACTTGGAGAAGAATATGGCCAACCGCCTTGCGGTTCTCGGGGGATCCAAGCAGCTCGTCCATTTTTGTGTGGACCGCCTGGAGATCTA
CCTTGACGAATCCTACTGCTACGTCAACCACGTCACGGGCTAGACGTGACTGATGGCAGATAAGATTCGTTACGGTAAGACTGGTCGAGGTACAGGGTAA
GAAGCTTTTGTACTGATATTCTGTTAATTTTCAAACTGGTGCTTTTATTTATGTGTACGTAGCGTGTTTATTATTTGCTGCCGGGATAATTAAAAGCAAG
GGTGCAGTAATGACGGGTGGTTTCGTTGAAAATTCCATTAAAGTTTGGAATTCGACCCTCGAGCGAGAGAGAGGGGGTGACGATTACCATGGCAAGTTTG
ATGCTGCCCAATTTGAGCACTGGTTTGAGCAACTTTGCACACTGTGTAAGTTGTGTGGATGCAACATTTATTTAGATGGTGCATCTTATCACAACCGTGA
GATCAATCTAAGTCCACGAAATCAGGGTGGCGGAAGGCCGATATTCTAGAATGACTCCGCAAGAACGGTAACTTTTATTATTTTGATACGAGTTTGGTTT
TTACTGTCAAAAACAAAATGTGTTCTTCTAGGTGACATGGTGTTTAGTTGTAGTAATACAGCTACAATTGCCACTCTGGTTGAGTTGGTAGAGCTCTGCT
TTTATACAAGTAACATATGTATTGTGATCACCAGCTTTTTTGCCTGTTCCAATTGTAAATCCATCGATTTATCGCCCGATTTATAATTAGGAACCCAGAT
TTAGTATATAAATACGGCGCCTAACACTGAATTAGGACACATCACCCGGGTTTGCACTCATGATTGGGCTGCCATATTTAGCACGCGTCTGGCGGATTTA
TTGGGGTGCAAGCGATTTATTTTTAAATCCTCCCAAATGCCCGAATGCAAATCGGCATTCGGGGAGTTGCGCATATATATATCGGCCACGTCGACTGACA
GTCATGCTGATTCAAGTTGCTGTGAAGGTCGGAGACATAGGGCGATCAAGCAGAACAAATGTGCGTGTGGAGGATGGTAGGTTCCCGCTCGACGACGAAA
GCGAGGACTTTGGACAGCTCTGCGCCAAGGTTGATGAGCGCGTCTCCAGTGCGCTGCGGAACTATGAGCAGAAGGCCATCCGCCAGGACTCAAATCTCTA
CCTGAAGCCTGGCCTAACTGCTGCGCAGAAGGATTGGGTCTCGCTGACCGCCGATAACTGGATGGCCAAGATCGACATAGCGCGCAGCAACTATTTGAAG
CGCACGAAGGCTGGTGGACCATTCGTCGTTGAAGTGTTCGTCTTCGTCGCCAAGAAACAGCCCGGTATTCGGCGTCCACCGCAAATCGGTCGAAGAGGCT
TCCCGTGCAATTGACGACATACTGATTGAGCGACCCGACATTCAAGTCGGTGCTATTTCGCGCACTCACTGGGCCATGTCACATGCACGACAACCGGACG
GGACGCTGCCGACAGTGCCGGACACGGCTACCTTCCGTCAAGCCCAGCACCTGGATGCAATGCGAGCGGCGCAGCAGCCGGACGACCGCGAAGAAGAGAT
CATGCGCACGCTTACCGTCAGCGTGAACGGCTCTACACCTCTGCAACTGACATTCAATGTCAACGATCTTCGAGCGCTGCTAGGACTTCCCGGGTACAAC
TTTCTGGCAGATGGCATCTTCTCCTCGTTCCAGCCCCCTTCGGAACCTGATGACGTTGAGGACACCGACCACACATAAACGGCAGGAGCGGCATCTATTT
TCTTAAGGAAATGCATCAACATGTATATTTTCCTTCTCGCTACGCTCGCAAAATCTTCCACCACCCACCCCACCTCCCATTCCGCCTCCCCGCGGTACTA
CATGGAGTCGAGGTCAAAACGAAAGACAGCGTCATTCAGACCGGCATCACCGTAACCACAATGGCGAAAGAGGTTCACACCTGTCTCGTCGGACTTGACG
CATGCTTTCATTGCTACTTCCAACACACGCTCTGGATACAGTGGGAAAGTCAAGTTGGCGTGCCGAGCTAACCACTTCTTGAGCTGGCCAAACATTACCT
CGATGGGGTTGTACTGCGGGCAGTAGGGCGGAAGAAATAGTAGGATAGCCCCACAGCCGTGGACCGCCTCCTCCAGTTCCTTGTACATGTGAATCCGCGC
GTTATCGAGTACCACAATCGATCGTGGGAGCGGCCACGGGTTCAACTGACGAACGATGCTGCCAATGAATGCTCGGTGGAACTTGAGCCGAGTGAACGTG
CCCCGCGTCGTCTTCCACGCAACGAACCCCCGTACGTCGCACGCCGCAAGAATAGACACCCGATTTCCACGGGCAAATGGAACCCGCACGACAGCCCGCA
TCCCTCGCTTCGACCAAGCGTACCTACGCATACTGTCGAGCCCATTCTTGGAGGTCTCATCGAGAAAGAGGACCTGCTCGGGGTACCGGTACCAGCAGCG
TAGCTTGGCGACGAAAGTCTCAATTTCATGAGGGAGCGCCTCTCGTGCCCGGCGCTCTAGCACCTTGCGTGATAGACTCAACTCGAACCGGAGGATGCGC
AGGATAGTAGAGGCCGACAGCTCGCTATGCGTCTCTGCGAAACGGCGCCGCAACTCGACTTGCAACTCTTCCACGAAGAAGGTTGGGTGTTCCTTCACGT
AGTCAGCAATAAAGTCGACCAGCTCAGGTGCATGTCGTCCTTGTGCCGCGCGTTGGCCAGGTAGCACGTCGCCTGACTTCTTGAATAAGGCGTACCATCG
CCGTACAGTGCGCCCCGCAACCCCAAATATTCTGGCAACGCGCTCGCATGGAATCGCGTACACATAGTGGAGCACGACAGCTCTCCATCGAAAGTCGGAG
GCATACATCCAAATGTAGGTCTTGCGTATGAACGGAACTGGTGGTCTCGCTTTCCAGCGTCAGCATGGCCAGTCGTGTTGAATTCCCCCAGCCGGTTTCA
GGCTAATCGGCCGTTTTGAAGTTCCCTTTATTACGTTCTTTTATCCTGTTTTGTACTCCGATTTATCACCCTTTGAAACTCTGATTTCACTCAACATAAA
TCCGTCCGGAACCCTTTAGTGATACCATTTTGCCAGGGACAAAAAACCTGGTGATCACAATAGCTGATGTTATTAATACTCCGCTTTCATTGTGTAATAT
TATCCCAGTGGATAGGTTGCATGACATAGGATAGGCTGTTTGTAACGTCCACGTTGAAGTTGAGTCTGCAAGCAAGCCAAGTGAGCCTGCAAGCAAGCCA
AGTGAGCCTGCAAGCAAGTCTGACGTCCATAACATAATACTGCACTCTGACCAGTGGCCAACGAAGAATAGTACTGCGCGTCATGCTGTCCAGGACGGCC
TTCTCGCGTGCCCCCCATGGCAGCGCCATCGCATGTCCGGTGGCAGACCATGTGACCTTTCGGGCGCCATGCTTTCGATAATGGGAAGTGTAGCTCCGGC
TACCGAGAAAACGGCCCGCGCTGACTAGCTCGCCACTTGCTCGTCAAATGTTGGGATTCTCAGCAGCAAGGCCGCCACCAAGCTCGGACCTTCGGACTGA
TTTAGGCTATCGCCATGACCACCGCCGCGAGGCACGGCTACATGTAAGTCAGTGCTACAGAGTGGTCAGCCCGGATTCGCATACGGCCCGCGATGGGGGG
ACCGAGGGAAGCACGCCCAAGTTGATCAGTTGGCAGCTGAGCTGCGGGCAAGCGATAAAGATGAGCGTGAATCCACAGCCACAGCCACCCGTTCGCGGCA
TCGGTGTGCATGTAGCGCTTGCTGCCTGACGAGCTCGAACATCATTGCAGCGAAGACAAACCGCAGCTATTATCTTGACGACCAAAGCAATACCCTCACA
GCAACATGGCCATTGCGCCGTCAGTGTGAAGTTCCGCTTCTGGCATGAGGAAATTCGCTCGCGGAGCCTGATTTTAGTTCCTGATTTATAGGAAATTTGG
ACGCGGCTGCCTTAGGTCCCACTTTCAAGAGCATAGTGAGCCCAAGTCACGAGTCAGCCTTTTTGACAGCAGAAGTATCGAACAGGCACAGTGGTCCTTC
TCGTACTTAGCCGGATAAACCCACGGTCTCCCACCGCTATTTCCGCGCGTAAAACCGCCCAGCCAACTTTGCACTTACTTCTTGTATGTGCATCGCATTA
TCTACGCACATTAACTCGCTGCCGCACCGCCTTGAACCGATTTTGGGTCCCAGGCCAGCCGCCCCTCCAGCACCCTTCCTGGGCGCCGCGCACAAGCGAA
AACGCTGCGCCGAAGCCGCGACGAAAGCAAGCGAACGCCGCCAGAAACCAGGCCGCTTGCTGAATAAGATCCGCCCTACAGTCCACCGCCACGCAGACAC
CTGGATCTGCTAGAGCGTTGCAAGGTGTCCGGGCCCATTGACGATCCCTCCTCCATGCTGATGACCGAGACGTACACTCCGGCGGGCGCCACCGCCGCCT
CCAACAGCCTCCTGGACGCCGACGCCGAGGCCTTCAACGAGCGTCTGCGACTCAAGATCCAGCCCAGCCCGCCCCAGTTCCCGTACCGAGACGACCCCTT
CGAGCTCACCGTGTACCTAGTGGACCCCGCTGATCATCTCAAGTCCGGGTACGTCCACGTCGGTTGCTAACGTTAGGGTATATGAGGTCTAATGGTCCTG
ATGTCGCTGCTGTTAGAGTGACGGTGCCGCTCCATGTGGAGCTGTACGCGGCCGAGAAGATGATGCCCGTGGAGAAGGACATCCTGCACATCGACCCCAG
CACCAAGCCCGTCATGAACGGCGACGGCATCTGCAAGCTGCGCGTGAGCATCGGCGAGTGCTCCATGGCGCTGGGCAACCGCAAGTTCGTGATCCACATC
TCGGCCGCCTCCACCAAGGAGACGGCGCACCTCAACGTAACGCCCGCCGTCACGTCCGAGATGACGGTCATCCAGCACCGGCTGCTCATCCAGGAGAAGC
TGCCCGAGCTCTGGTACAAGGACGAAGGTGGTCGCGACAAGTGCATGACGCTGCCCATCTTCCTCGTGAACGCCAAGAACGAGCGCGTGGGCAATCGCCC
CGTGCCGCTGCGGGTCACGCTGCTATACGAAAACGAGCACCCAGTGCTGAAGCAGGACATCCTAAAGATGTCGCCGGACTGCCAGCGCACCATCGACTCG
ACGGGCAAGGCCGTGCTCAAGCTGCGTATTGAGGACGTGTCCAAGAACCACCAGGGCCAGGCCTTCCGTCTGAAGGTGGAGGCCGACACGGCACAGTCTC
CGCTCAACTTCGACGTGGCGTACGACCTCAGCTCCTCGATCTCTGTGCGCTCCAAGCGCAACAAGCGTCGCCCAGGAAAGAGCGCCCCCGCGCAGATCAC
TCATCACATTATCACTGGCTCGTCGACGCCGATGTCGACGACGTCGTCGCCTGCTTCCAACGCCGATCATGAGATGATGCTGGCTGGAGCCTTTGGCACT
GCTGCGTTCACAGCCGAAGATCGGCGCAAGAGAATGCGCACCGGGGGAGGCAGTGCCTCGCCTGGAACACCGCGAGTGGGCGGTAGTCCACAGTCGTCCA
ATTCTCTCACTGGCGCCATGGAGAGCATTTTGAACTGGGCCGGCGGTGTTGTGAACGGCCTTCACCAGTTAGAGTGGCAGACGGTGGGCTACGAAAGCAG
GACTGACGGCACGGCGGATACGGAACGCCCCATCTATCGCTGTCCTGCATGCTGGCGATACAAAGATGTCATGACGTACGAAACGGCCCAACACGACACG
AAATGCCTGATCGCCAATCTTTTGCTCACGTACGCGACGGACACCATGGGTCATCTGGACTTCGTGCTCAAGGGCATCGAGCGGTTTCCAGCGATGATTG
CCAGTGCGCAGGCTGCCGCACAGAAAGCAGCAGCGAAGCCGATGGGGCAAATGACGAGCCAGAATCCGTCTCTTGTGAGTCCACAGAATGGCATTATGGG
CGTCAACCCGCTGACGGACGACACATCCTCGACCCAACAAATGATGAGCTCGGCAATGATGATGAACTCTAGTATGGGGAGTACTGCGACCGCAAACCAA
TTCTCGATGAGCAACAGCTCGTCAGCGATGGCGACAACGACATCAGGCGCCATGACCAACCTCCCTGGTATGGAGGGTCCTCCCGGCTTGTTCCGCAACA
ACTCGGGTGGCCTGACAGAGTTCATGCGCTCGTTGGATGACCAGGACTCGAACGACCCGATGTTTTACCAGAACCTCGCTGGCGGGGGGAACAACAATAG
CAATGGCAACCACATTGTCGATGCGATTGAGGTGCAGGTGTTTTACGTGGTGGCGCGTATGGTTACGCTGAACGCGAGCAACGCTATTGGCTTCCCCGCT
TTCGATGTCAGTATGAACCTTTTGGGATTTTACCAAGAAGGTCGCGAAAACGCAACCACCGAGGTCGTGTTTGTACCCGTGAGTGACATTCCCGCCATTT
CGCAAGGCGAAATCATGGAGACCCAGCGGCTGCTGCAAGGGGAAATGAAGGGCAATAGCGCTGCAGTGCACACATTGGCGCGCTGCAACAACGATTTGGT
GAAGTTGAAAGAAGATGTGATTCTTTTCCACTGGAACGCCAAGGACCGGATTACGCCGAAGTGGTAAAGTGACTTTGGTGCACTGCCTATTGGTTTATAT
CAGCACCAAGTGACCACAAAGTACGCAAGTGCAGCTCTACAGAGTAAATGCCCAGAAAGAGATAATACCATCGGGCTCGATGGAGATGGAATACAACGCC
GGTGCGGCAGTGAGTGCATGTTGCATAACGAAATGTTGTATAGAAGTAATCCCGCGCGCGACTCGGAACACGATGAACGCCAAGATGAAACTCGAGTGGG
CAAACGGAGAGGTAAACGTCCGAATGAATAGTATAAAGAAGCAATATAAACTCGATTGAATGCCACACGGGGCCGACCCGAGCTCGTCCCTATCGCGTTC
AAGTTGTGTTCAAGTCCGAACAGCGCTCGACCAAAAGCCGGCGAAATCCAAGAGTGACTGGATGCTTTGTATCGACTAGTGTCCGCAGCGTCTTCTTGAG
CTTCTGCTTTGGTGGGAAGTCTTGGCCATTAATACTGCGGAGGATGTCACCGATGGCTACGAGTTTCGAGTTCTTGGCTTGTCCCGGTCTGATTCGCTTC
ACGTAGACAACGAGAGCGTTTCGCTGATCGGCATCTTCATAGCAGCCAAACGTGATTCCTAGCTCCCCTTCATTCCAGAGAATGCTGTACAATGACCCGA
ACGGTGGGTTTCTGCTGTTGAAGACTCCATCATCCAGCCCAGACGAGCAGTCCGACAGGAATGTCCGCTGGAAGCCCGGTGGGCCGTCTCGCTTGCGGAA
GCGTAGCACTGCAGGTTTTGTAGCGACCTGTAGGAGGGTCCGTAGTTGCGTCGAACTCAGACCGGAAGTGAACCAGTTGTTGACACACACAAGGAGATGT
CCGACGGCGTCACTCGGCAGATCAAGAGCAGACTCCTTGAGAATCTTCTGGACGATGGGATACTGGCCTCGAGTGTGGTGTGGTATCTCGAGCTTCAAGC
CCAGTCGGGCTGTGGTCCATAGCACCTCGTACTCGTGTTGTTCGCGGATGAAGGATAATCGCAGAGAGTGGCGGTGCTGCACTGCCTGTCTAGCTAACGA
TCGATGGCCATTCGCTTTCAGCTCGGCCTCACTGCTGGAACAGATGCTTCGAGACAAAGACAGAGGTGAAGACTGGGAGCTGTGGTCAGAGTTGTTGTCT
TCCTCTTCACTTGTGTCGTCAGACAGGGGCGGCCGAAAGATAAGTTTCACGGGTTTCGGCAGCTGTACGAGGTCCCGACACAGGAATTTAAAAGCTTGGC
CTTCGGTTCGTACGCCGTTTATTGAGTACAGCTCGAATCCGTGTTGGAGGCTCTCCATGTTGGTCGATGAGCTTTTGCCAGTCAATCGATTCACAACTGG
TGCGCCTGAGATTGCATCTTCCAGTAGTGTCAAGCCCAGGGGGTCTGTCCTCCACTCGATATGAACGTCGCTGCATGTGAAGCTTGGCGACGCGGCGCTA
TGACTGTCTGCCGGCTCAAGTTGTAAATGCGGCGGATCCGACTGACTGCCTGCAGGAACCAGTGAGCGCAAGAATTCTCTGCATCGAAGGCCTGCAGTGG
CTCGAGCCTTCATGCCGGCCTCCGTCAGATTGGGAATAGCGCTGCGCAGGGAAAATCGGTGCTCTTTAGTTTGATCACTTGCGTCCTGGATACCAAGCCA
CCTCTCGCGATCGCCATCGTTCACAACACGCTCGAATATTAGCCGCACTGGCCGTGGACACTTCGCTAGGTAGTCCATTGTTGGGTCGAGTCCAGCGGCA
ACAGCGTCCATACCGTTTACAGCTACAAGTACATCGCCAAGATGGAAACCCGACGCAGAGGAGACGGAGCCACTACTGAAGCCACCCAAGCTATGACGAC
TACTGCTGATCCGAGTTACAACGGGGATATCGTGACTACCATCTCGTGTAAGTGAGAGGCCCAAGTTCTGTCGGCCATGAAGAATGTCAAAACGGATACG
TTTTCCGCTTGTCGCCGAGCAAAAGCGAATTATCGATGGGCTCTTTGACATTTGCACCAGCACTATCGCTGCCTCGGCATCCATGGTGTGCACACGTCTG
TTTCCAACGGTCTCCAATATGTCTCCAGGGCGAACTCCTGCCTCCCACACCTTCAACGCTGTGACGCGCTTCACCACCAGCTCCGCATCTTCGTCCGAAG
GTGCAGTTGCGCCTGCATCATTCCCCGCAGTCGTCAAGGTGAACCCGGGGTCACCGCCAGTCCAGACGTAAAACCGAAGGCACGCAAAGTCCTCGTGGCT
GGAGCTCCAAGACCCAGGACTGTGTGCCGACAAATGGGTCATACGTGCCGTGGCAGCAGAACGCGAGTGTTGCTGGCCACCCTCGCGTCTGAAGAATAGA
GCCTTTCGTAGACTGTCTAACGGCATCAGCGCAGTGGACTGCGGCGATCAGCGAGTTCTTGCCGGTACGAGGAGAATTCGAGAGTGTCTGCGCCAAATGC
AGCGTTAGGTCAGGCGTGTCCTAATCCATCGAGTGAAGCAGACATTGAAAGGGTCGCGTTCTTCTTGGTTGTCCACCCGTGCTCGTCGCTAGCCATCCGA
AGCCACGACACCATCATGTGTTGATAGACAGCTCCAAAACGCTGCTAAAAAGGCTGACGCAAACAGGAGTGATGAATATCTTTGTTGAAGTTGACCATCA
CTCTCCGCTCCGAATCCTAATTAACCAATATGAATTGATTGATACCAGTTATGTGTTCCTATTTTTGGCGGTACTTTGCATTCAAACCGCTGTCAGCAGC
TCTCAAGATGAAGCGCTTGGCGTCGCAACCGATCACCGCCTTCTTCCAGCGCAAACAGTCTCGCCGCCGCAGCATCGAGTCCGTCGACAGCGATGCCAGC
GCCAGTCCCAACACCCATCCAGCCGACCAAGTCGAAGAGATCCAAGACGAAGAAGGCCCCAATGAGCCTCCGACTACGAAGCGCAACGCCCACGCGCGTC
GAGAAGCTCGCGAGGACGTGACGGGGATTCTGCAGCGCCGCGAGCTCGTGGGTTGCGCGTCCACGCGGTTATTCGTGGGTTCGCAGGGCCCAAGACGCCG
CCGCAAGCAGCAACTGGTGCGCTGGGCGCTCACGCACTCCCAGCGGCTGCCGGTGGAGCTGCAGCTCGCTCCTCATTGGGAACGTCAGGCGGGGGCCATG
AACAATGAGCGCTTCTATGCCAGCTGCCTCGAGTTCGACGCGCAGGGAGTGCTGCTGGCGGCAGGGGCGTCCAATGGGATCGTCGCTTTGTATGACTTCG
ACGACGTCTTCCATCGCAGTCTCAACCTCGGACAAGTGAGAGAGTGGAGGGGTGGAGGCCGTTTTCTATGAGTGGGAGATTGACTTGTGGAACTTGCTGT
GGATAGCGCTTGCTTAACCAACAGGTACGCAAGGACGAAGAGGAACCGAGTGCAGCTGATACCGATGTGACTGAAGTGCAGCAGGAGGTTAAGTTGCCAG
ATGAGATACTGCACCCGGTACGTCTCAGCATCTTGGGCAATTGACGGCCTGGGAACTTATGGTGTGCGTGGGTACAGATCCACACCATCTTTACTCCGTT
TGAAGTCAAGTGCATTCGCTGGACCCCTTCAAATGAGGTACCTGAGCGTATTAATCAAGTTTCGTAGAGTTCATTTAAATTGTGCTGACTGTACGTTTTT
GTTAGGATGAGATTGCGTGCTCGTTCTCGAACAGGAACGAGATTCATTTGTTCAATCTCCGCAAGTTTCCGAGCAAGCCACACAAAGTCTTGAAGAGCTC
CAACCACCCCTCAAGTGGGTACAATGACTTGTTGTACCTACCGACAACGGAATCGACGCTTCCCAGCATACGGCCGCCAGGCATGATAAAACAGAAATCA
CGTGCAAGGACAACCAATGTCATCGCTGGCGATACGGATGGAGCTATTCGCATGTGGGACGTTCGGTCCCCCATGCGGCCAATTTGGAGCTTTCTCACAG
GTTCGCAGCCCATCAACTCAATCGTGCTGTCTCCAAACAAGCAGTGTGTTATCTGTGGCAATGAGGCTGGAATGCTTATGGTTTGTCTACACGAACACCT
TGTAGCGGCCGAGAGTTCTCTGACTGTTGCTACTTCTTTATTCCTTGGCATGCAGACATACGATATTCAGCATAAGATCGTCCCCGCGTTTGGCTCTAAG
CCTGTGCCGCAGCGAAGGGCATCACTTAACATTATGGAGGCGATCAAACGTAAGAACTTTTCGCTCATGGATTTTATTACATGCAGATGGAAGCCAGACT
GACAAATGCTGAGCTGGTATTTTCTCTTTGAATGTGGATCGACCAGCATACATATCACCTGCGTGTATCGAGTCTGTTCTCCTCTCAAGCCGCTCCGGAT
CACCTGGCATTATATCAATTCACTTAGTGCCGCATTCTGAGACTCAAGTCTTGTGCCAGTTGCGCAACGACTGGGTAGTTGTCATTGATTATCTTGTCGG
TTCTGTCGTGAAGCTTCATACGTCCATCCGAGGTACGTCCTCCGGAAAGCGATCATGGTGATCCCTGAATGTCAGCTCACACATTCGTACACACGAATGT
TGATGGCCTGCTTGTCATTGAACAGGGTTACCCAAGCAGAAGTCCAAGTCGGACGCGTCGCCATCTGTGCTCTCAGCGGCCGCAGAGATGGACTCCCAGC
GGGATTTCTTGCCGCGATCGTTGCGTAACTCGTGGCTTTCTTGTCATCGTTGCACGGGGACTTTCCTGTTCGACGAGTCAATCATGTGCACCGGGATCCA
TGATGCAACGAACCTGAACGTGATCGATATGCACCAGCTCCAGCATTGGCATGCTGCTGCCACCTCAACAAAAGACGATGCGGACAAAGTTGAGACGGCG
AGATCCAGT