Description :
From Genome Similarity Track
Location :
Scaffold_13:6479- 8214
Transcript NameFunction/comments
Phyke_g911mitochondrial-processing peptidase subunit alpha, putative
Phyke_g912hypothetical protein PHYSODRAFT_342126

Sequence
1735 bases(100 bases per row)
AGCACAGAAACGCGTTGGAGCTTCACCCCCATTGCATCCCGTCCGCCTCTCGATCGATATGCTAGCGTCCTCCAAGCTTACGGTGCGCGCCACGCGCTCG
CTGTTCACCAAGGCCAGCACCATGCCCAGCGTGGCTCTGAGCGAAGAATTCCCTTCGGTACCCAAGGCCCAGCCCAAACCCGCGGCCGCTGCCAAGCTCA
CGACGTCCACGTCCTCGTCGGGCCTCAAGCTCAGCTCGGACGACCGTAGCGCCACTGTCGCCACCATCGGCGTGCAGCTGAACACCGGTTCGCGTgacga
gacggaggagacTGCTGGTGTATCGCAGCTGTTCGCCAAGCTGGCGTTCCGTGCTACGCAGACCCGCTCGGACCTGCGTCTGTACCGTGACATTGAGGCC
ATTGGCGGCGTCGTCAACGCCCAGGCGGGCCGTGATTTCGTCCGTTACAGTGTCAGTGTGCTGCCTGACcagctggaggctgctgccgacATCCTGGCGG
AAACGACGCTGTCCCCCAAGTTCTCTCTCTACGATGTGGAGGAGCAGAGGAAGATCGTGCAGGCTGAGTTTGAAAAGATCGtggatgacgctgaagcaTC
TATCATTGAAAGCAtccacgctgctgctttctACGACGATGTTTCCCTCGGACGCTCGGTGGCTGACGTCGAGAATCTCAAGGCTCTGAGCCCCGAAGCC
GTCTGGGCTTTCTACGACAAGTACGTGAACGCCTCCAACGCTGCTCTCGTgggtgctggtgtggctCACAACACACTGTCCGACCTCGCTAACCAGTACT
TTGGCTCCATTGCCAAGGGCAACAAGGCTACTAGCGTCAAGGCCAAGTACGTTGGTGGTGAGACTCGTGTCAAGAAGGCTGGCAAGTTCACGCACGTCGC
TTTGGCTCTGCCCACTGCTGGCCGTGAGTCGGCTGACTTTGGTGCTACCCAGGTGCTGCGCGCTTTGCTGAACCTGCGactcaacaacaagaaggcgTCG
GCCTTCCTGTCGAGCTACAGCGACGCCGCTCTCGTGGGCCTGTCGGGTTACGCCGCTCACTCGGAGGCTGGCGCTCTCGTGGACTCGTTCGCGGctgagc
tcaagaaggctgcGTCGGCTCCGGCTACCAAGGAGGAATTGACTACTGCCAAGACCACGGCTGCGCTGGAGGCTCTGGAGACGTACAGCACCCAGGCGGG
TACTCTGGGCCGTGTGGGCCTCGTGGCTACCTCAGACTTCGCGGCCAAGTCGCCGTCGGAGCTTGTGGAGGGTGTGTCTGCAgccaagctgcaggaactg
gcGCAGAAGGCTCTGAAGGCCACGCCGTCTGTGGCGGCCATCGGCAAATTGTCGACGGTGCCCCACGTGGACGCGGTTGCCAGCAAGCTGCAGTAAACAA
ACTCCAAGACGATCGATCAAGAGTGAGGTACATACATCAGTCTAACAGCCTGAACTTTTGGTGAACATGTTGTGATGGTGTGAAGATGAGCAGGGCAGCG
TCAAGTGTGGAAGTAATGTAGAACCCCGGATAAGGAAGGGGACAGCAAGGTGGATAGGATTCAGACACACTTGCAGCTAGCCTAGCGCCGAGGTGACGGA
ACGTGTGATGAACGCACTAAACTCAAGAAAAAGCAACAACTTTTTAATCATTCGGTCAAGGAAGCCGCACTTCAATCTCACATTTGTTGCAGTTTGTTTT
AGTCGCTCAAAAGCTGTCCGACAACTGCAGTAAGA