Description :
From Genome Similarity Track
Location :
contig_10:647867- 649637
Transcript NameFunction/comments
g3390.t1KUF75820.1 Cathepsin cysteine protease [Phytophthora nicotianae

Sequence
1770 bases(100 bases per row)
TCTACAAGAAGAAGGACTTTTGGCTCGTCAAGAACTCGTGGGGCGACTCCTGGGGCATGAAGGGCTACATCATGATGAGCCGCAACAAGGACAACCAGTG
CGGCATCGCCACGGACGCCTCGTACCCGATCATGACGAAAGGGGAGGAGACTGCCCTCAAGATGGAGAGCGTGGCGATGGTCGAGGAGACGACGGAGGTG
GCCAGCATCATGTGAGCTTGCGAGCGACGGATGCCCAACGCCCAGTACGGAGCGGTATAATGCATGTAAAGTTTGACAGCCTCCTCCGACCGGTAGGTCT
CGGAGAGATGGATGCTGTTACGAATGCACACGTTGCCGTCTTTTACTTTCGTCTTGGTTGGCAGCTTTGCGTAGATGTTGATGGCAAGGATGGCGACGTT
TGGCACACGTCGCAGGTAAATCGGACATAGCCGGATGCTACCCTATCCACTCGCACAATCTTTCCAAATGATTGTGCCCGTAGCCAGGGTGCCCAAAATA
CGTCCCCAAAAGGAGTACAGAAACAAATCTTGGCAAAATGGCACTCCATAACCAAAATACCAAAGCAGAGTGATTGAAGTGTTAGTAGGGCCCACTCTCG
ATGTTGAGCGAGTGACATAACCATCCACGAGGTTCTCTCGCCTTTCAAACGATGAATCCGGCATTGGCCCCGCGAAAGACTGCAAGTGATCAACGAGGAA
ACACTTTCATTAAGATTTCTCTTCAGTCCCAGCCACCCTCACTCTCTCACTTTTCATTTCGCCTACTCGTCGGGACTGCCAACTATCGACAAACCATCGA
ATCAGCTAGAGCTGCTCGCTTTTACCATGCAGTCCAAGTTTCTCATCGTGTGCTGCCTGTGTGCCGCCACCTCGATCCTGCACGCGACCGAGGCCGGTCC
AGCACGCGGAATCGCGCCGTGCAGCAACCTGGACTCTGGCCAGGACTACTACGGACACCCGTAGCACCGCCACGACAAGCACTACCGTCGCCGCCTCGCC
GAGGACAAGGCCGCTACCGAGTCAGAAGGACTACGACGAGGCTACGGATACGATGACTATGACTATGATACAAGGGCTACGGTGGTGACTACGACGACTT
CGGCCACGACGACTACAGCTATGGCAAGGACGTCTACGACTATGGATACGGCTACCCGGACTACTCGTCGTACGGCGGAGGCTTCGGCTATTACTCGGAC
TCGTACTCGACCTACGGCTACGGCTACGGCTACCCGGGCAACTTCGGCTACGGATACGGGTACCCGGGCTACTTTGGCTACGAGTCTACTGCGACGGATG
CTGGTGCTGTTACAAAGGAGTCTGCTACTGTTGCCGTGATGATGCGTCGGTCAAGCCAATGGAAACGAAGGAGAGCTAGATGTAGCAAATACAAATGCCA
GTTGATAGAGCGATGCTGGCATTTCGTGCACCAGCGTATCCGTCGGGGATACTTTAAAGCCCATTTTTATGGAGAGCATTTTACGGGCAATGTATCCGGA
AAAGCAGCCCAAAACTGGACTATACAAACCGCAAGATCGATTCTGAACTTTGCGCACTTCAAGCGTCACATCGCATGTGCGGCCCAATTTGGCCTCATTG
CAAGTTAGCGCTGCAAAAGCGCAAAACAGGCAGCAGCGCGAGGAGGTCTTGCCCCTAGCACAGAGCAGTCCGAGCCAGTGGTGGAGGCAGCCGCGAGATG
GGATTCAGTAGCCGCGGGGGCAAACTTCAACTGGGGGACGACGTCAGTGGCGGCGTCACAAGCCCAGTGC