Description :
From Genome Similarity Track
Location :
Scaffold_33:64783- 65865
Sequence
1082 bases(100 bases per row)
CGAACTTCTGAGTCATATAAAATATCTTGAGGATAGACGGCGAGCGTTGACATCAAGGAGTCGACTACCTGACCCGCCAGAAGAATCTCGATCTGTCACA
GACCTATTATCCTCGATTGGAACGGGACTACGGGCGTATTTCGGCTCCAACGAAGAACGAAGACAAGCTCGTACACGTGTTATGTCCATGCAGCTAGCTC
TTGGCCAACCGGCCATATTTTTTTACGATATCTCCCAGCTGCAGTTCAGCATACCGTGTGGCAAACTTGGCAGGAGATATGCCTGACCATTTACTGGAGG
AAAACCAACACGTGATGCAGGAGTGCCTAAAATACACCACGGCAAAACTTGGTATGATTGCAACGAGTAATCCTGCTGCCTGCTCTCAATATTATAATTA
CGTTATGGAAATTGTCATTGACGTAATACTTAATTGGGACAGAGATAAACACTGTTCAAAACCAGGAGGAGGTCTTTTTGGTGTTACAGAGGCCTTTTAC
GCAGCGACAGAAACCCAAGGTTCAACTGGAAACCTGCATGGGTATATGTTGATACGGGTGGAAGGAATGCCTGCAACGGTAAAAGAATATTATCAATCAT
GCCAACTGGATGACGTGAAAAAGAGGCTCCTAGAGTATGTTGAATCAATTGCGAGCTCTAATTTCCCCGCCAATACCGAAGTATGCCCATCATGCCATGA
AAGTAAACTTACACCGATGCCTCTTTCGATGGACGCGTTTCAACGTCCGCGGAAAAACCAAGAACGTCCAATTACAGCAAAGTGCACTGGTTGTCGACGA
AACTTTGGAGAAAACGAAATAATCCGAGGGCAACTCACCGCATATGCCTTGGCAAACTCGTTGGATATTGAAGATTTCGGTGACACTGCGATAAAATATC
ATATCGCTAAACCTCAACCATTACCGCTACCAGATGACCATCGAGCAATTTCCAATTTATTGGTGAGTAGGGCACTAATCGAGTATCAAGCTCACCACTG
GTACCATTGCCGGTCATGCTTTAAGTGCACCAGGCGTACACCAAAAGGAAATGTTTGCAGAATGTTTTTCCCAAAGGAAACA