Description :
From Genome Similarity Track
Location :
contig_10:647707- 649477
Transcript NameFunction/comments
g3567.t1hypothetical protein

Sequence
1770 bases(100 bases per row)
GCAGCTTCACGTTCCAGCTGTACCGCCACGGCGTGTACAGCTGGCCGCTGTGTGGCAACGCGCCCGATGCGCTGGACCACGGCGTGGCGGCGGCCGGCTA
TGGAGTCTACAAGAAGAAGGACTTTTGGCTCGTCAAGAACTCGTGGGGCGACTCCTGGGGCATGAAGGGCTACATCATGATGAGCCGCAACAAGGACAAC
CAGTGCGGCATCGCCACGGACGCCTCGTACCCGATCATGACGAAAGGGGAGGAGACTGCCCTCAAGATGGAGAGCGTGGCGATGGTCGAGGAGACGACGG
AGGTGGCCAGCATCATGTGAGCTTGCGAGCGACGGATGCCCAACGCCCAGTACGGAGCGGTATAATGCATGTAAAGTTTGACAGCCTCCTCCGACCGGTA
GGTCTCGGAGAGATGGATGCTGTTACGAATGCACACGTTGCCGTCTTTTACTTTCGTCTTGGTTGGCAGCTTTGCGTAGATGTTGATGGCAAGGATGGCG
ACGTTTGGCACACGTCGCAGGTAAATCGGACATAGTCGGATGCTACCCTATCCTCTCGCACAATCTTTCCAAATGATTGTGCCCGAAGCCAGGGTGCCCA
AAATACGTCCCCAAAAGGAGTACAGAAACAAATCTTGGCAAAATGGCATTCCATAACCAAAATACCAAAGCAGAGTGATTGAAGTATTAGTAGGGCCCAC
TCTCGATGTTGAGCGAGTGACATAACCATCCACAAGGTTCTCTCGCCTTTCAAACGATGAATCCGGCATTGGCCCCGCGAAAGACTGCAAGTGATCAACG
AGGAAACGCTTTCATTAAGATTTCTCTTCAGTCCCAGCCACCCTCACTCTCTTACTTTTCATTTCGCCTACTCGTCGGGACTGCCAGCTACCGACAAACC
ATCGAATCAGCTAGAGCTGCTCGCTTTTACCATGCAGTCCAAGTTTCTCATCGTGTGCTGCCTGTGTGCCGCCGCCTCGATCCTGCACGCGACCGAGGCC
GGTCCAGCACGCGGAATCGCGCCGTGCAGCAACCTGGACTCTGGCCAGGACTACTACGGACACCCGTAGCACCGCCACGACAAGCACTACCGTCGCCGCC
TCGCCGAGGACAAGGCCGCTACCGAGTCGGAAGGACTACGACGAGGCTACGGATACGATGACTATGACTATGATACAAGGGCTACGGTGGTGACTACGAC
GACTTCGGCCACGACGACTACAGCTATGGCAAGGACGTCTACGACTATGGATACGGCTACCCGGACTACTCGTCGTACGGCGGAGGCTTCGGCTATTACT
CGGACTCGTACTCGACCTACGGCTACGGCTACGGCTACCCGGGCAACTTCGGCTACGGCTACGGGTACCCGGGCTACTTTGGCTACGAGTCTACTGCGAC
GGATGCTGATGCTGTTACAAAGGAGTCTGCTACTGTTGCCGTGATGATGCGTCGGTCAAGCCAATGGAAACGAAGGAGAGCTAGATGTAGCAAATACAAA
TGCCAGTTGATAGAGCGATGCTGGCATTTCGTGCACCAGCGTATCCGTCGGGGATACTTTAAAGCCCATTTTTATGGAGAGCATTTTACGGGCAATGTAT
CCGGAAAAGCAGCCCAAAACTGGACTATACAAACCGCAAGATCGATTCTGAACTTTGCGCACTTCAAGCGTCACATCGCATGTGCGGCCCAATTTGGCCT
CACTGCAAGTTAGCGCCGCAAAAGCGCAAAACAGGCAGCAGCGCGAGGAGGTCTTGCCCCTAGCACAGAG