Description :
From Genome Similarity Track
Location :
Scaffold_74:64770- 71738
Transcript NameFunction/comments
Physo_139439reverse transcriptase

Sequence
6968 bases(100 bases per row)
TACATTGGCCAGTTCTGCAACCTGACTAGTGACCTACTTGCAAGTGCAGATCCCCGATCCACCCGGAGTTACTACTTGGCCGGGTGCATCCTCAACTCTC
AACCTCTACGGATCCCGCTATAGGAAGCGGCAAGTACAACAAAGGAAGACCTACGAAGGCAAAGGAAAGGAACAACAACCCAAAGGCCACCCCACGGCCG
GATCCAGATCCAGGCCGCCCGATCCAAGTCGACTACCACTGGATTGGGAATAACTACCGCGAGCAGAGTGAAGATTTCCGCGCTGCTCCACCCACATCCC
CGCGTCTCGCCCCGACTGTTCTGTCTTCAAGGCTCGGACGCTTCAGCAGACACCAGAGGAGCAGATCCAGCCCTACCGACGGGCACACAAGGTGACCAGT
TCAGCACACAGATCACGGATCATAGGGGGACCCCCTCCGTAAGTCGGTGTTCGGGCGCAGTTGGTAAGTTGGATTGGCAATCTCGCAGATTTTGCTGATC
CCGCTACATCACAATGATGCGCGTGCCCGGATCTTCTGGTGACTCGGGCTTTCACCGTGAGTCCCAAGAAGAAGTTCGAGCGAAGAAGGAACAAGGGGAT
CAAGCGTCATCGGAGTCGGGATCGGCGACGACGCTGCTGAATGAACCAAGATCCACGGATCGACAGAGTGCAAGGAGGACCTCTGCCGGCAGAACCGAAG
TGGTTCCAGACATGGATCCAGAAGAGAAACCTCAACCTCCTCCACAGGTCCCTTCGGGACCCCGGTGGATCGCAACGCGAGTCAAGATCCACCAACAAAA
CAAACCAAGGCTGGCAAGGATAGGTATGCATTTGCTGATTCACCAGTTAAACCGGATGCCTCCCGACAAGACCAAGTCGATGACACGAGCGAAGATGAAG
GCCCCGGATCTGGATGACGAAGATCCAAAAACGTCATCCCACGAAGAATCCGAGGAGGCAGGCTGGAGACGCTACCACGAGAAGCAGCTACGTGACTTCC
TGGCTTGGGATCCCATGATGCGGCTGCTTGGCGTGAAGCCGATCGGAGACCTGCAGGGGCCTGTGGCACTCCCAGCACCCGCCAAGCGTGAAGGGATCCT
GGCCGAGATGGAGCGACTCATGCAGCTGCTGAAGGAGGCCAGCCTCGTAGCTGGCGCCTTCGACGCGCGAGCGATCTACGACGTCGACCCAATCCAGATC
CACGCGACGACGGACATGCTGTTCAACAGGCTGAAGGCGTTGGTAGGTGAGATCCAGCTGAAGCCGGATCCAGAAGTCCCGGATCCAAGTTCACCTCAAG
CTGGATCCACAGTATGCCGAACGTCGTCACCATACGTGTCTGCCGCGGAGCTTGGGTCGGATACATCTTCGGAGCCGCGGCGTATGTCGCTTGGACCCTC
GGGGGCCTCGATGCTACGCGCCCGAGCCCAGATCCAACGTGAAGCAAGGACTCAGTCCCGATCCCAGCCCCGATACAAGAAGCCGTCAACTCCTTCGGTG
GATCCAACAGCTACGGCATCAGGATCGAACATATCGGCTGGCAGGCTTGAGTCGTACTTTCAGGCAGCCATGGGCAGGTTCTTGAAGGAGCAAGGCGTGT
TGACCCCGACACAGGCGCAGGAGGCGACGCAGAACCCCGGATCCCAGGACGTGGAAATGGAGTCCACTGGTTCGTCCGATCCAGATCAACACTGGGAGTA
CGATCCAGATGACATCGACTTCCCGGTCCCAGCTCGCGCTACAGTGGCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACATCCACCGGAGTCAGATCCGGTGTCAGCAGCAGACGGCGAAGCGACACAGCTGAGGGTGCCCCGGGTAGC
GTCTACCCGGGTGCAAGAAGCCCAAGCTGCTGCGCCTAATCGTAACACCCGCTCCCGATCCAGACGAAGCTCACGCTGAATGCGCGCCCGGCTTGGATCC
AAACGCCGATCCCAATGTCGAAGACTCGCTGGGATCAGACGATGGATCGACAGACCAAGGTCCGACAACTGGCACGCAAGTCTGCGAAGGGGGGCTAGAT
CCAGCTGATATGGGACAGGCGGCCCATCCCGTTGTCGCATCGGGTGGTAATCACGAAGAGACAGGGGGCGGATCTGCAGATTCAACAGATGGTGCTACGG
GACAGGTCATGGATCCAGTGGAACGTCAAGTTGCAGATGGTGAGATGGGACAGGGTGCAGCTCCAGACGGAGAGAAGAGACAGGAATCAGGTCCGACGTC
AGATCCAACGGCCAGCCCCGATCCAACGACCACTGAAAATCCGCGGTACAATGACTCGGAGGCGGATGACCAAGTCTGTTACCATGTGAGTGGGGATCTA
CACGCGGAAGACCTTGAAGCTGAGATGGCCGTATTACCCGAAGTTACTCCGGCTACACAAGAGGTGACAATCGAAGACATCCAAGTGGGGGATCCAGATG
TTAATACGGCGGAAGAGATTGACCGGCTTCGGCGACGGATATGGAGGCGCCGACACCTGCTGATTGGCGAAGACAACGCGCTGCCTCCTGCGCGAGGCGT
CGTGTGTGACATCGATGTCGGGGATGCTAAACCCATTGCCCAGCGTGTGCGGAAGGTGGCGCCGCAGTATCTCGGATCTGATCAAGGGATTGCTCGGTGC
CAAGATCATTAAGGATTCAACTTCCCCATGGGCATCCCCGATCGTGGTCATCATCAAGAAGAATGGATTGGATATAAGGTTGTGTATTGATTACCGACTG
GTTAACAATCTGACCAGACTGATGATCTACCCGATGCCCTTGATTAACGATCTACTGGAGGATCTGGACAAAGTGTTGTGGTATTGCTCGTTGGATAAGG
CCAGTGGATTCTGGGTGGTGACTATGACCGATCGGGCTCGTGCGATTTCCGCTTTCATCACCCCGTTCGGATTGTACGAGTGGAACCGGATGCCCTTCGG
GTGGAAGAATGCGGCTCAGATATATCAACGGATGCTGGACAACGCGCTGTATGGGTTCACCCGGATCCCACAGTTGGAAGGTGGATCGGGATCGGACAGC
AGATCGAAGGTCACGTGTGGGATTGGATCGAAATCACTGGATCTGGATCTGAGGTCAGGAGAGCCTGAGGACCCTGGCAAACCGTCGGTACTTGGACGGT
GATCCTACATTGACGACATCTTGGTGACCGCTGGATCCTGGGACCACTTGTGCGACCGGGTGGATGCTCTGCTGGACGCGTGTGATAAATGGAATCTTTC
GATCAGTGTGGTAAAAAGCTTCTGGGGCAAGAGCAAGGTGGAGTATCTAGGCCATCGAGTGTCCCATGCTGGATTGGAGGCGAATCCTAAGGATCTATCA
GCCCTGACGGATCTACCCTTCCCAGGGTCACTCCGATCCATGCAGTCATTCCTCGGCAGCCTGAACTATTACAGTCGGTTCCTGGAGGACTATGCGATCT
ACGCTGCAGTTCTCTATGAGCTACGAGAAGTGGACTTCGCCGCGATGAGTAAGCCGGACAACCAAAAGTGCATCCAAGTCGCCATGGGTTTGACGACCCC
GGATCCAATGGATCTGGACTCGTCGGATCCATTAGGGCCAAGGACGGTGGATCTACGACTTCGATCCACAGAAACTTCCGACCTGGAGGCGAAGGATCCT
GTCGGCGTGAGGGCCTTGGATCCGGAGACGTGCGACCCAGGCAATGTGGATCTACGCTGGATCCGAGCTCATCGGGCCTTCGTGACACTGAAGGAGAAGA
TGGCGAGGACTCCAATCCTCCGACACTTCAATGTGGATCTGCTGCCAGTGGTGGTGGTGTATGCTAGTGAGTGGGCCATTTCGGCCGCTCTGATGCAGGA
GTATGACGGGATCCATTACCCAGTCACCTTCACCAGCCGCACTCTGAAATCGAACGAGCTCAATTACGGCGTCGTCGAAAAGGAGGTGCTAGCCCTGCTG
CGGATTCTGGATCTGAGCTACAATATGTTGGTGGGTCGCCAGATCCGGGTCCTGACTAGGCACTCGACGCTGGCCTGGCTGTTTCGATCCACTGGTCTGT
AAGGACGGTTAGGACAGTGGGCCGCACTCCTTTCGCCAGGGACTCTTGAAATTATGAAGTGCGCAAAGGGCGAGGATGAGTTCCTAGGAGCGCTGGCAGC
CAGTATCACACCCCGATCCAAGGTGGATCGGGCCTTGATCGACATCGCGCCTAAGAAGGAGTCGCGACGCAAGATCCAAGCTCCGATCCCGACAGTACAA
CCTGGTGAAGAACTCTATGTGCTCAGCTTTGATGGATCGGCGCGTGTCAAGCGACGAGGAGGCGCCGACAGTGCGATTCTTTGGAAACTGCCAGGGTGGA
TCGTGGTGAAGGCTAGATCCGGGTATGCCGAAGGCCTTACCGTCAACAAAGCAGAATATCACGGACTTCTGCTATGCTTGGATCTACTCGAAGACGAGGC
GCAGCGACGACTTGTGATCTGTCGTGACTCCAATCTGGTGGTCCGCCAGGTCCGAGATGATATCGACTGCAAGGCACCTGGATTGACGCTGTTGAGGCAG
AAGGTGCTGGATCTACTACGTGTTTGGCCCAACCATGAGCTGGTGCATGTCAAGCGCGACTGGAACGGTAGTGCCGACAGTCTCGCTAGCGTGGCACTTC
AACGTCAAGCCGGAATCATAGTTGAGGATGAAGCGGACATGCAGGATCTAGTCACCCTGAACCGCCTGGATGAGATCCTGGTGGTGAAGACTGAAGAGGA
TGCTCCCGACGCTCGGGTGTCGCCCGTAACAACCCGAGCTGGTGCAAGATCCCGATCCAACTCCCGACCTACATCCAATCCACAGGTCCTACAGGAAGAA
GTGGTGAGAGACCTCCGGATGGCTAGGATCCGCCAAGCGCAGGACGAGGAAACGTGGGTTTCCGGCTTGAAGAAGTATCTGGCGGGCGATATTCAAGGTC
TGACGCAGGAGGAAGCCCGATCCTACGGTATTATTGCGATGGATTACGAAGTGGATCGGAACGACCTGCTCTTCTACTGCCCTCCGACGAAGAAGGTGGA
GGCGGATCGCGATGGATTGATGAGGCTAGTGCTTCCAGAGACGCTGCAGCGAGTATCCTTCATCACTACCCTGTCCGTCTGGAAGGAGGCCACCAAGGGA
TCGGCCGTACCTACCAGCGGATCCGAGATTACTTCCATTGGAGAGGCTTGTATCGGAGTGTCCAGCAATATGTCGGAGAGTGTGTGGATTGCGAAACCGG
CAAAGGGCGGCCCACGATCCAAGGCGAGTCGCCTGGCAACATCCAAGCCACATACCCGTTCCAGATGATAGCGATGGATCACATACCGTCGCTGCCCAGA
TCCAACAAAGGTAATACCGAGTTGTTGATGTGGGTGGATCTGTTTACCGGGACTGTCACACCGGTAGC