Description :
From Genome Similarity Track
Location :
contig_10:647683- 650050
Transcript NameFunction/comments
g3567.t1hypothetical protein

Sequence
2367 bases(100 bases per row)
TGCAGGCGGTGGCGATCGACGCGAGCAGCTTCACGTTCCAGCTGTACCGCCACGGCGTGTACAGCTGGCCGCTGTGTGGCAACGCGCCCGATGCGCTGGA
CCACGGCGTGGCGGCGGCCGGCTATGGAGTCTACAAGAAGAAGGACTTTTGGCTCGTCAAGAACTCGTGGGGCGACTCCTGGGGCATGAAGGGCTACATC
ATGATGAGCCGCAACAAGGACAACCAGTGCGGCATCGCCACGGACGCCTCGTACCCGATCATGACGAAAGGGGAGGAGACTGCCCTCAAGATGGAGAGCG
TGGCGATGGTCGAGGAGACGACGGAGGTGGCCAGCATCATGTGAGCTTGCGAGCGACGGATGCCCAACGCCCAGTACGGAGCGGTATAATGCATGTAAAG
TTTGACAGCCTCCTCCGACCGGTAGGTCTCGGAGAGATGGATGCTGTTACGAATGCACACGTTGCCGTCTTTTACTTTCGTCTTGGTTGGCAGCTTTGCG
TAGATGTTGATGGCAAGGATGGCGACGTTTGGCACACGTCGCAGGTAAATCGGACATAGTCGGATGCTACCCTATCCTCTCGCACAATCTTTCCAAATGA
TTGTGCCCGAAGCCAGGGTGCCCAAAATACGTCCCCAAAAGGAGTACAGAAACAAATCTTGGCAAAATGGCATTCCATAACCAAAATACCAAAGCAGAGT
GATTGAAGTATTAGTAGGGCCCACTCTCGATGTTGAGCGAGTGACATAACCATCCACAAGGTTCTCTCGCCTTTCAAACGATGAATCCGGCATTGGCCCC
GCGAAAGACTGCAAGTGATCAACGAGGAAACGCTTTCATTAAGATTTCTCTTCAGTCCCAGCCACCCTCACTCTCTTACTTTTCATTTCGCCTACTCGTC
GGGACTGCCAGCTACCGACAAACCATCGAATCAGCTAGAGCTGCTCGCTTTTACCATGCAGTCCAAGTTTCTCATCGTGTGCTGCCTGTGTGCCGCCGCC
TCGATCCTGCACGCGACCGAGGCCGGTCCAGCACGCGGAATCGCGCCGTGCAGCAACCTGGACTCTGGCCAGGACTACTACGGACACCCGTAGCACCGCC
ACGACAAGCACTACCGTCGCCGCCTCGCCGAGGACAAGGCCGCTACCGAGTCGGAAGGACTACGACGAGGCTACGGATACGATGACTATGACTATGATAC
AAGGGCTACGGTGGTGACTACGACGACTTCGGCCACGACGACTACAGCTATGGCAAGGACGTCTACGACTATGGATACGGCTACCCGGACTACTCGTCGT
ACGGCGGAGGCTTCGGCTATTACTCGGACTCGTACTCGACCTACGGCTACGGCTACGGCTACCCGGGCAACTTCGGCTACGGCTACGGGTACCCGGGCTA
CTTTGGCTACGAGTCTACTGCGACGGATGCTGATGCTGTTACAAAGGAGTCTGCTACTGTTGCCGTGATGATGCGTCGGTCAAGCCAATGGAAACGAAGG
AGAGCTAGATGTAGCAAATACAAATGCCAGTTGATAGAGCGATGCTGGCATTTCGTGCACCAGCGTATCCGTCGGGGATACTTTAAAGCCCATTTTTATG
GAGAGCATTTTACGGGCAATGTATCCGGAAAAGCAGCCCAAAACTGGACTATACAAACCGCAAGATCGATTCTGAACTTTGCGCACTTCAAGCGTCACAT
CGCATGTGCGGCCCAATTTGGCCTCACTGCAAGTTAGCGCCGCAAAAGCGCAAAACAGGCAGCAGCGCGAGGAGGTCTTGCCCCTAGCACAGAGCAGCCC
GAGCCAGTGGTGGAGGCAGCCGCGAGATGGGATTCAGTAGCCGCGGGGGCAAACTTCAACTGGGGGGCGACGTCAGTGGCGGCGTCACAAGCCCAGTGCC
GTCGCCTCTTCTTCGCCCAAAATGACGTATCGTGTCTTTCCCCCAAGCAGCTCGCCCAAATCTGTGACGCGGAGGCTCGTACTCCGCGCGCATTGGTCAA
AATGCGCCTTCCGAAGCAGCTGTCATTCGCCAAAACTCGAATACGCGCCTCGCATTGGCCATAAAGCGTTCGGAGCGCGGGCCGCACGTGTCATGTCTCG
CTTCGTACTTAGCGTTGAACCCTCACTTTTCGAGTGTCTTTTGCTTACTCGGCAACGAGTGGACATGTTTTCCCTCTGGGGCGGGCCGTTTCCTTCCCTT
TCTTCCCGAGTTGGTACATTTCCCAATTAGCCCTACGTCTGCCACGCCTTCACGTTGTACCAGACTTCACACCATGGAGAGCACCAGAACCACCAGCTCC
AACGCCCAGCTGCAGCTCAGCTCCTTCATGTCGCTCGACGCCGACGACGAGATGGCCCAGCTCATCC