Description :
From Genome Similarity Track
Location :
contig_5:647624- 648908
Sequence
1284 bases(100 bases per row)
GCTCACCAGAAGATTCAAACAGCTACCCGTGCTGCGGAGCCAATTGCGTGAACGTGTTTTGTTCTTCTTGCTACCACCTACTATCAGCAAAAAACAAGCT
GTGTGAAGAATGCTTTCAGCATGAAATAACCCCAGAAGAAACCTTTGGCGAACAACTTCGCGTGGTGCTAATTGAGAAAATTGGCGCCTCCGACCAGCAG
CGAACACGGTTGGAAGATATATTTCGGTCTTTCGACGTAGATGGGTCGGGTGCACTAAGCCCGCAAGAGTTTGAGAAAATGCTTCTGCTTTTGAATGTCC
AGCCCCCTCTTACTCAAGGACAGAAAACCTTTCTTATTGACCAATTTGATGCGAATGCTGATGGTGAGATCAGTTTGACTGAGTTCAAACATTGGATACT
CAGAGACCGGGTGTGGGAAGAATCACCAGCGTTGCCTACAAACCCTGAAAATAAGACCCATACTGTAGCAGAGGCCTTCGATACTGTCATCAGTCCCATA
TGCGATGAAATTATAGACTTGGCATACAACGCACATGCGTTCAGCTCTACTATTGGATCCTGGTCCCGCTCAGCAAACTCGATCTCTGAAGGCCAAATTA
ACCCGTCACAAACAGGAGAAACTGGAACTATCCTGTTTCAACGAGTTATCAGTCTTGGTATTGCTTTAAGTGCAGCAACAAATGCCGCTGAGAAGGTCTT
TGAGCAGGTTGACGGTGACGGCAGTGGGATCATCGACCAGTATGAATTTGTAGACTTGCTTTCAGCCTTGGGCATTCATCTCCGTTTTGAAGATGCAAAA
TTGCTCATGAATCGTTTGAGTGCTTCACCAGTAGGTAATGGGAGCAGTACAATTACACGGTCTGCCTTTATTGCTTACGTTGAACAAACCAATATACAAT
CGCCAATCGGTAAAACTGCAGTTGGGCTAAGCGAGGTGCTGATTCGCCTGGATGCGCTTGCTGGGTCTGAAGCTACTGTTCGAGATATTTTGCAGAGCGA
GTGCCAACGACTACACGAACATATGAGCGAGAAGGACTTGCTGATGGTTTGCAAGGCTCTTGATGAGAAAACAGGACTTGTCATCGGCGTGGATGAATTG
CATTCTTTGGCCACCAACCTATCCCTTCACTTTGAAGCACCCGTGTCATCCTCGAACTCAACGGTGGTTGACAGTAATGTCCAATCGATATCATATAAGT
CTAGTGGAGATCTTTTGGCCCGGTCTTTGCTAGCAGACACGAGCGGTTTGATGAAATACGTAAAGTCATTCGATGCTGTGGCTA