Description :
From Genome Similarity Track
Location :
Scaffold_1046:6476- 8811
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_1046-abinit-gene-0.7Transient receptor potential Ca2 channel (TRP-CC) family protein

Sequence
2335 bases(100 bases per row)
CGCGTGTACGGAAAAATCAACAACTCGTACTTTGCGTACTGGCTCGTGGTTTGCTCCATGGTCGTCATCGCGCTCGAAGTCATGGCGGTTATCGTCGTCA
GACACGCCTTCAACTCGACCCACGACGAGCACGGGAACCGCATCGTGTCTCACCACCAGCGGTCCTTATTGCTGTTGGAAAAAGACCCAGTGAAGCCCGA
CGACGCGTGCGACTGGCGCCTCAAGCTGCTGCGTGGGATGCACTACGTCGGGATCCCCAACATCCTCCTCGTGGCGCCCGTGCTCTTCTCGTCCGAATGC
TTTGCGCTCTACAAGTCCAAGCACAACCGCATCGTGCGCCGCCCGTACCTGCAGGTCTGCGAGCTCATGATCACGCTTCAGATGGCGTTCATGATCTACT
TTGCTGCCGATCAGGTGTTCAACCTGCCTGAGACGATCCACTGCCACGAAAAGTACACGGCCAGCGAGATCGCGATGCTCTACTCGGCGTTCGTGATGTG
GATCGTGCTCATGCGCCAGATCGTGGTCTTCTGCCGCTTCATCACGCACCAGAAGCTACAGGCCGACGGTGCCAACGACGCCAACCACACGTCCGAGATG
AGCTCTTGGATGAAGCGGTGAGTAGTGGTGACTGTGTACTGCGCTTTGTGAAGAGAGGAACTAACGTTATCCACTCTCGTTGTGCTGTAGGATCATGTCG
TGGCCTGGACTCACGGAGAGCAACCGCAGTGCAAAGATCTTCAAGAAGAAACTGTACCGAGCAGTGATCCGCGGCGACGTCGAGGGCGCGCAGCGGCTGC
TGGAGGAAACCAAGGAGACCTACGGCATCGCCTGCGTGAACGACCTCTATCGCTCGCCCGTGATGTGGTGCTACGCGTTCGCGCAGTCGTGTAAGAACCC
GCTCCACGTGGCCGCGATCCACGGCAACGTCATGATGGTGCACCTGCTCATCCTCCACGGATTTGACGTGAACGCGCTCGACAAGGTGGCGCGCGTGAAC
TTTAACCTCGGACTGCTCTTCAAGATCTGCACGCGCATCCTGGTGCGTTGCTATAAAAGACCAAGGATCACATGGCTGGTTATGAGTTGCTGACGATGTT
TGTATGTGATTGCTGAACCAGATTCGCACCCAGGACGGTCTCAAGTCTCCGCTCAAGTCAGTTCTCTGCACTGTGCTGCTGCCTCCGATCCACGGTGCAG
TCGCCAGCGGCCACGTCAACATCGTTCGCCTGCTCATCGAAAATGGTGCGAACGTGAACGCTCTGCCAAAGGCATCATTCTACTACCCCGCGGGTGTGCT
GCCGCCCATCTTTGTCGCCGATGATCCTCAGGTTCTCCAGCTGCTGGTCGCGAACGGTGCAAACTTCCTGCACGTCGCTTCGGTCTCGCTCTCGGGGATG
GTGCAGACCTTTGCGACGCCGCTGCAGCGCGCCGCGTTCACGATGCGCTCCTCACTGAGCGACTACCTGGTCGAGAACGGTGGTGACGTGGCACTGACCC
CACTGCACACTGCATCCGCGTCGGGCAATATAAAGACAGTGAGGTCGCTGCTGGCCCATGGTACGCAAGTGGATACTTTGGGGGAGCGTGTGGAGGGTGT
GCACGGTCGCACGGCACTGCACTGGGCTGCGATCGTCGGCAAGGTCTCGTCAGCGAGAGTCCTGTTGCGGAAAGGCGCCGACCCGAAGGCGCAGGACCGC
GATGGACGAACGCCTCTGCACTGGGCAGCGCACAACGATCACTCAGAGATGGTCGACCTGCTGCTCGCGAATGGCGCGGACCCGAACGCCCAGGATCTTG
AAGGCAGCCCCATTCTGTGCTTTGCCGCTGAAGCCGAGGGCGTGAGCTACGGCACGATCTCCAGTCTCGTGACTGCTGGCGCGTCTCTCAAGTACAAGGT
CGTGAACGGCGACACTGCGCTCCACATCGCGCTCCAGCGTGAGAACCGCCAGACCGCACTGTCGCTGATCAAGTGCGGCGCCAACATGATGACGACCAAC
AGTTTTGGCAAGCGCCCCGTGGATTGCACGACGTCCACGGAGCTCCAGTTCACGCTCAAGAAGGAGGCTGGCAGCCGCGACGTGATGATCTCGTACACGC
ACACGCACTTTGAGTTTGCACAGCAGGTGCGCGAGTACCTGGAGAGCCACTGCTCAATGACGTGCTGGATGGACACGATGGACCCGAGCGGCATCGGCGG
CGGCGCCGTCTGGCGCGAGGAGATCGCGCGCGGCATCCAGAAGTGCTCCATCGTGCTCAGCCTCGTGTGCGATGGCTACACCAAGTCCGACTGGTGTCTC
AAGGAGCTGGCGCTCGCCAAGAACATCCGGAAGCC