Description :
From Genome Similarity Track
Location :
Scaffold_824:6476- 8636
Transcript NameFunction/comments
Phypl_g11160hypothetical protein PHYSODRAFT_511709

Sequence
2160 bases(100 bases per row)
AAACACCCACGGCTCGCGGCCGGCGAAATCTCACGTACATATATTTTCATCGCTGGACCCAGAGAAGCCTGATCTTCTATTTGTTGCCATTGCCTACACT
TTTGCAACTAAAACAAATAGGAACAGAAGGCACTTCGTCCGTGCAGTTCCATTTGCTGTTAGTTtacctgctgctgtggaagCTGACACGAGCAACTCGC
CGAGCATCGAAGGACAAATTGCGGCCTGATAGTGTACACACTCGCTGGGTCGGCGGCTACGCCCTTCGTCTTGATTTCTTcgggtcgctgctgctctgtt
CCGCGGACTTTGATTGCTGCTTGTACGTGGACTTCTCCGCCGTCTTTGGTCCATTCGACGGGTTGTCGAGGCTGGAGGGTTATGTCATTTTCCTTGTggt
tgtcttcgtcgcttaCTCTtgctgtgcgtgtgtgtgtgtgctgaTGTGTTGGATCTGCTCGTGGTACTTGTTCTATCCATCGCGTGTGCTACTGCTGCCC
ACCCAGGGGCTCTATTCAACCCGCTGCTCCGGGATCCGCTCGAAGCGCCGGTTACTCGAGGCGCCACAGCTCATATTCTTCGGAGGGCCAATGTGGATCG
ATCCGCGGTAGCTGCCTCCAGCGAAGCTGTTCTGAGGCATGCCCACTTGCGCCCGCCTCTCGCGCGTGCAAATGTAGTGTCCGGCAAGTCCTTCGGCCGG
GATCAAGTAGCCCAGAGAGACCGTGCGGCGCGGGCCTTCGCGAACTGAGGGAAGGCCACTCACCGGTAGCACGGGGTCAATCTGGAAGCTTTCGTCGTTA
GAAATCAGCACCAACTCGATGTTAAACATGCTCGCCACCGCGTACAACTCGGCAGTCGTAGCCTGTTCGTCCGGTGTATCCCTGAAGGTCTCATACTGCT
CCCGCAcatcctcctcgtcctgcatcaGGAAGCCCGCGAGCTCCTTAATGTGCCCTAGCGCGTACTCCATGAGCTTCACCCTCAAAAACTGCGCTGCCGC
CACTCGCCGAGGGGCCATGCCGTCCGCGGCGCCCACGTTCACCACCGTCATGCTCGCCGGGTAGTCGCGCAGACACTGCAGCGGGTACATCTCGTAGACA
ATGCAGTGCAGCAAGCAGGATCCGTCGGGGGGCATCCCCACGCCCACAAGGCCCACCTGCACGAGCTGatcctccatcttggcgcgctgcatgTCCAGTT
CGGGCGTAATGACGTCGGGCGCCGTCATGGCCATCATGGATCCCCTCGAGACTGACGACATGGACGCGCGTCCAGCGGTGTCGGACacggcggacgacgc
cggGAACCAGCTCCCTCTGGACGACCCGGGGCCGACGGACCCGGCGAAGGAATTGCTAGCAAAGGagcctctgctgctggcgaaggaCGTGCGTCCGCCC
CCCATCTGCACTTGGGGCACCGTGTGTCTGGCGAAGCTCTGGCTGCCCACGAAGCCCGTGCCGGACCAGCGGTAGTCGCTGGCCGTGGAGGCGAAGGACG
AGaccgtggagctgctggagaccgagcggaagtcgtcgtcgtcgtcccccatgacgctggccgtggcctgCACCACCGCGGGGGacgccaagatggacga
ggacggtCTCAGATTCACGTCCTGCTGGTCGTACTCGGCGTTGGCGCCGAAGCCCGAGTTGAAGCCCACGAAGCTCTTGAGCGTCTGGCTGGTCACCGCC
CCCAGGTGgaaggccacgagctgcggcttgtGCGTGACCACGTTCATGTAGTTGTCGAGCTCCCGCGCCCGCACCCCGAGGAACTCGGGGCTCTTGTCCG
CGCGGAAGAGCGCCTTGCGCCGGTATAGCGGGGGGAACTTGAcgcccttgagcagcgcggcgctgcgcttgcgcagctgctcgtcgagcttgcggaaggc
cgagaagctgcgccagaTGTGCCAGCTCGTGCGCCCCGAGGCGTGCGCGCGCGACGAGTAGAAGgagagctgcacgacgaccTTGTActcggccttcttg
ctgctcagGCGGTAGTCGTCCACGCTCACGGCGCACGTGTAGTCGCCCTGGATGTCGTCGGGCGTCATGGTCAGGTAGGCCATGCGCAAGCGGGTTCCGA
TGCCGAGTgacgccaagctcgcggGCTCTCGGACTCTGACTTGACGACGATCGCAAGACG